Emerging Markets Essay Example | Topics and Well Written Essays - 2000 words - 1

Emerging Markets - Essay Example While developing economies are usually flooded with emerging markets, the concept is not novel to developed economies. It is these emerging markets, which when successful in the future, become economic giants in the industry (Garten, 1997). The emerging markets need to consider a lot of geographical and economic concerns before setting in a foreign country. They may be small enterprises or large projects. This paper seeks to evaluate the industry of emerging markets in the United States and see how successful it has been over the years. It would also analyze how these emerging markets have affected the economy of US and all related economies. Emerging markets have had positive impacts and some negative setbacks and this paper would state both sides of the picture. The US is the third largest country in the world comprising an area of 3.79 million square miles. It accommodates over 300 million people in fifty states, and being so, it remains the most populated region in the world. The US is the most ethnically diverse nation in the world with people from all over the world staying there for work, study or leisure. It has a GDP of 14.3 trillion US dollars which proves that it is a relatively economically stable country in the world. However, about 11% of the US population lives below the poverty line (Juster, 1997). It has a very high rate of productivity and high rate of scientific developments and innovations. Also, the unemployment level in the US is fairly low and inflation is under control too. The US is bordered by the Pacific and Atlantic Oceans making it a favorable site for water travel. Also, it has sufficient nuclear weaponry and a strong army to ensure its defense against the worldly enemies. The US also enjoys fairly good relations with most economies of the world and it stands as a much unbiased nation with a lot of

Use of cell phones in a workplace Essay Example for Free

Use of cell phones in a workplace Essay The use of mobile phones has become pervasive not only for social interaction but also in the day to day transactions. Tyrone Garage is a business where they are four (4) mechanics that travel around the country to repair customer vehicles 24 hours a day and also travel overseas to buy different car parts. Among the types of repair that Tyrone and his employees perform are tyre change or repair, tyre rotation, brake jobs, oil change , belt change etc . The use of nokia phones allow the mechanics to ommunicate with the garage, so they aware of where they are and can provide them with new customer information. The phones also allow the mechanics to communicate with customers such as getting the customer directions to their location. Although the garage and mechanics will call each other on the same network, the calls to customers will be on different networks. Tyrone Garage has a monthly plan with Digicel which includes 1500 minutes a month to be split between all the mechanics phones and this is used for communication between both the arage and the customers. Tyrone Garage employees use the nokia cell phones to set reminders of appointments that customer would have made. The nokia phones allows you to instantly check appointments you can also install an instant messaging chat whatsapp so you can communicate with an employee, or with the person you intend to meet at any time to confirm, clarify, or alter meeting details (e. g. location, time). This means that if meeting needs to be changed at the last minute, all parties involved can be informed quickly, even if on their way there. Three security features of Nokia phones that are useful to employees of Tyrone Garage are: Remote locking using SMS messages or security code Remote locking allows the device lock to be activated remotely where they will be a timing set on it where it can lock on it own. The end user themselves can do this by sending an sms from another user or sms emulator as long as a remote locking code is predefined in the terminal. Remote locking code can be from 5 to 20 characters or digits. If the device is lost the person who finds the phone still cannot activate any nformation on the phone even if they change the sim card because when they insert the new sim card and turn on the phone that person has to enter a security code before the phone is actually boot up. This feature reduces the risk of the device being stolen and increases the possibility of having the phone returned if misplaced or lost since it has the company label at the back of the phone. Call Barring This feature allows the employer to restrict all international outgoing calls from employees phone

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

The Legacy of Russia and the Soviet Union - Authoritarian and Repressiv

The Legacy of Russia and the Soviet Union - Authoritarian and Repressive Traditions that Refuse to Die There circulated such a Soviet political anecdote: The ghost of Nicolas II visited Brezhnev to inquire about the conditions of his Mother Russia, only to be told that nothing had changed since his reign except for that the vodka was now 20 percent instead of 15. Shocked, the dead czar exclaimed: "I lost my head only for that 5 percent difference?" This was, of course, only a humorous exaggeration, a case of political satire. Yet beneath the humor, there lies a very profound testament to the belief that Russia's political culture has been inherited from its czarist days and manifested throughout its subsequent development. The traditions from the pre-Revolution and pre-1921 Russia, it seems, had left its brand on the 70-years of Communist rule. The Soviet communism system was at once a foreign import from Germany and a Russian creation: "on the one hand it is international and a world phenomenon; on the other hand it is national and Russian†¦it was Russian history which determined its limits and shaped its character." (Berdyaev, "Origin") Historically, Russia has always been a country of perplexing dualities. The reality of Dual Russia, the separation of the official culture from that of the common people, persisted after the Revolution of 1917 and the Civil War. The Czarist Russia was at once modernized and backward: St. Petersburg and Moscow stood as the highly developed industrial centers of the country and two of the capitals of Europe, yet the overwhelming majority of the population were subsistent farms who lived on mir; French was the official language and the elites were highly literate, yet 82% of the populati... ...oved to be singularly influential and daunting. This is, perhaps, the greatest obstacles to achieving true democracy in Russia—the authoritarian and repressive traditions that refuse to die out with the passage of time. Works Cited Berdyaev, Nicolas. The Origin of Russian Communism. London: Saunders, 1937. Cohen, Stephen. Rethinking the Soviet Experience. New York: Oxford University Press, 1986. Fitzpatrick, Sheila. The Russian Revolution. New York: Oxford University Press, 1994. Hosking, Jeoffery. The First Socialist Society. Cambridge: Harvard University Press, 1993. Tucker, Robert C. "The Mortal Danger". Course Reader for World Culture: Russia Since 1917. New York University, Spring 2001. Tucker, Robert C. "Stalinism as Revolution from Above". Stalinism. Edited by Robert C. Tucker. New York: American Council of Learned Societies, 1999.

Khmer Rouge and Stable Communist Environment

How is it that between the Cambodian Genocide and the Holocaust, over eight million people were killed? The similarities and differences between the Cambodian Genocide and the Holocaust are both disturbing yet interesting. To understand how alike and dissimilar these two events are you must consider three things, which are: the cause, courses, and effects. The Cambodian Genocide was lit up by a man named Saloth Sar, better known as Pol Pot. He was a Cambodian Revolutionary as well as the man who created a communist group known greatly as The Khmer Rouge.Pol Pot and Hitler are similar in this way because Hitler also created a political power party known as the Nazis. Both of these leaders were important dictators who created murderous groups. Additionally, this wasn't the only similarity between the two because Pol Pot and hitler both promised something they couldn't back up. Pol Pot promised a stable communist environment , while Hitler promised a big change in their country. Neither of them were actually doing this for the better, but rather for themselves because they both wanted to have absolute power.The difference between the two of them was that Pol Pot had attempted stability and communism by trying to isolate Cambodia, giving the subtle hint that he would rather be somewhat of an underdog and safe, rather than on top and over powerful. In this case, Hitler was the exact opposite. Hitler wanted to be on top; he wanted to be the top dog. He wanted to make Germany a better country but his view and their view were much different. Hitler didn't want to make it better for the less fortunate, he just wanted to make it better for the, already to be know as, higher class.Furthermore, the way Pol Pot and Hitler ran things were very different but in the long run, they both had the same outcome: world wide tragedy for everyone but themselves. During the Cambodian Genocide and the Holocaust, many roles of symbolization came into play. For instance, throughout the Ge nocide everyone was forced to wear black pants and black shirts and in the Holocaust all jews were forced to wear prisoner clothing and of course, the star of david at all times. These weren't the only rules that were very strict.In Cambodia, if you wore glasses you were automatically death sentenced because you were considered to be different and in the Holocaust, you were refrained from wearing shoes. These harsh rules were just the begging of the torture for either countries. Throughout the course of these events, the very serious situations began to occur. In Cambodia, the torture began with labor fields, carried on with starvation and ended with execution but in the Holocaust everything was just thrown at them at once with the death camps and the gas chambers.Nobody can make any exception about not remembering the last step in the Holocaust which was the final solution. Pol Pot and Hitler had very different views on how to carry out the â€Å"organization† of things. Hit ler believed that only very particular people should carry on at the death camps and the rest were thrown into the gas chambers-such as women, child, weak, and certain age groups-. Pol Pot had little stereotypes such as grouping anyone intellectual, wealthy, or high class and they were to be executed together because they were â€Å"different†.The ones that lived through that, had little hope, but still more than the ones going through the Holocaust. One more thing that was similar between the Genocide and the Holocaust was that the population decreased dramatically. In Cambodia, people disappeared daily from camps and the starvation was killing quickly. In Germany, an estimated 4,000 or more jews were killed every single day from either being murdered, freezing, or starving. These deaths were nothing to be taking lightly, yet not enough people took it serious enough.This is one of the reasons both of these events were not stopped until it was too late. The effects of both of these treacherous events were devastating. An estimated 20% of the Cambodian population were murdered throughout four years under the power of the Khmer Rouge. In Germany an estimated six million jews were murdered between the time period of 1933-1945 under the power of Hitler and the Nazis. The punishment wasn't enough for either but at least the Nazis had to go threw the Nuremberg trials.

Evaluate Motivation Theories Essay

Individuals join and work in organizations to fulfill their needs. They are paying attention to organizations that have the means of sustaining their needs. These means are called incentives of rewards; organizations use them to encourage individuals to contribute their efforts toward achieving organizational goals. The continued existence of an organization depends on its ability to interest and encourage individuals to accomplish these organizational and personal goals. Newman (2010), â€Å"Motivation is defined as goal-directed behavior. It concerns the level of effort one exerts in pursuing a goal. Managers are concerned with this concept because it is closely related to employee satisfaction and job performance† (Para. The Concept of Motivation). There are 2 main concepts of theories Maslow’s and Herzberg. Maslow’s need hierarchy theory divides human needs into five levels; self-actualization, esteem, social, safety and physiological needs. Physiological nee ds are the basic human needs including food, clothing, shelter and other necessities of life. Once these are satisfied they no longer motivate the individual. Safety needs include economic security, protection from physical danger. Social needs are love, affection, emotional needs, warmth and friendship. Esteem can be self-esteem, self-respect, self-confidence and recognition. Herzberg found that the factors causing job satisfaction (and presumably motivation) were different from that causing job dissatisfaction. Herzberg called it hygiene factors, using the term â€Å"hygiene† in the sense that they are considered maintenance factors that are necessary to avoid dissatisfaction but that by themselves do not provide satisfaction. Company policy, supervision, relationship with boss, work conditions, salary and relationship are the leading in dissatisfaction. Achievement, recognition, work itself, responsibility, advancement and growth are the leading to satisfaction. The effectiveness of the application of these theories can be measured with observations of employee job satisfaction. Managers can evaluate satisfaction through employee surveys or by observing workers. References: Newman, M. (2010). Motivation. Retrieved from http://business.ezine9.com/motivation-149b57b275.html

Sex and the City TV Show Quotations

Sex and the City TV Show Quotations A perfect play on words, Sex and the City quotes are full of witticisms and unabashed humor.  Here is a refreshing collection of Sex and the City quotes for good coffee-time reading.   Great Quotes From Sex and the City Charlotte: I just know no matter how good I feel about myself, if I see Christy Turlington, I just wanna give up.Miranda: Well I just want to tie her down and force feed her lard, but thats the difference between you and me.Carrie: [to Big] Were so over we need a new word for over.Miranda: Im sorry, if a man is over thirty and single, theres something wrong with him. Its Darwinian. Theyre being weeded out or propagating the species.Detective: You Irish?Miranda: No, why?Detective: Coz you have beautiful red hair.Miranda: Well I guess anybody can be Irish with the right colorist.Carrie: There are 1.3 million single men in New York, 1.8 million single women, and of these more than 3 million people, about 12 think theyre having enough sex.Carrie: I like my money where I can see it - hanging in my closet.Miranda: Whatever happened to aging gracefully?Carrie: It got old.Carrie: When it comes to relationships, maybe we’re all in glass houses, and shouldn’t throw stones. Becaus e you can never really know. Some people are settling down, some are settling and some people refuse to settle for anything less than butterflies. Samanthas terrified to get an AIDS test...Samantha: What if I have it?Carrie: You dont have it.Samantha: Sometimes it takes me a really long time to get over a cold.Carrie: Thats not AIDS, thats central air conditioning.Samantha: Im a try-sexual. Ill try anything once.Miranda: Theyre starting to die on us.Charlotte: Oh my god.Samantha: Well at least you werent stood up.Miranda: 35 and theyre dying. We should just give up now.Carrie: Well, on the bright side, this could explain why they dont call back.Samantha: Hmm.Charlotte: How did he... ?Miranda: Heart attack.Samantha: Oh.Miranda: At the gym.Carrie: See, this is why I dont work out.Miranda: My marriage is going through a rough spot. I dont have time to wax!Samantha: [Upon seeing a firefighter stripper] Hello, 911. Im on fire!Carrie: Maybe some women arent meant to be tamed. Maybe they just need to run free until they find someone just as wild to run with.Mr. Big: Nice dress.Carrie: Meaning?Mr. Big: Nice dress.Carrie: [after hearing Big is moving to Napa, California] If your tired of New York you take a napa, you dont move to Napa! Charlotte: [On seeing the tacky floral arrangement at Mirandas mothers funeral] They were supposed to say Im sorry, I love you not Youre dead, lets disco!.Samantha: [to the girls] I think I have monogamy. I caught it from you.Carrie: Yes, its airborne.Charlotte: I was a teen model when the Ralph Lauren store opened in New Haven.Miranda: Okay, it was amazing that I could keep my lunch down just now.Miranda: Wow! A guy who doesnt want to get married! Film at eleven!Charlotte: So, which church does his mother go to?Carrie: Park Avenue Presbyterian.Charlotte: Good church! Its one of the best on the east side!Carrie: What, are you rating churches? Is there a Zagat guide for that?Miranda: Four stars. Great bread; disappointing wine selection. Carrie:  Now Ive laid down a gauntlet. He either has to say I love you back or I guess Im going to have to break up with him.Charlotte:  Well, how long are you going to give him?Carrie:  Well, I didnt put an expiration date on the sentiment, but I figure its got the shelf life of a dairy product. Its going to start to curdle in about a week.Duncan:  Im just one of those weird male aberrations who  prefers  to be married. I like stability, I like routine. I like knowing  theres  people waiting for me at home. I guess that makes me sound pretty dull.Miranda:  Are you kidding? Youre the heterosexual holy grail.Carrie:  So what type of movies do you compose for?Patrick:  Really bad ones. You know, the I Screamed When I Knew What You Did Last Summer on Elm Street type.Samantha:  You know, women dressing like men is very popular right now.Carrie:  And here I thought it was Pokemon.Steve:  Oh come on, I want a baby. It would be fun.Miranda:  Its not like owning a foosball table, Steve.Aidan:  Dont take this the wrong way but this place could use a little work.Carrie:  I know, but I cant afford it.Aidan:  Youve got eight thousand bucks worth of shoes over there.Carrie:  I needed those! Miranda:  (looking at a bride magazine)  Ooh! Cute purse!Charlotte:  No purses! Theres no time for purses! This is gown-specific!Miranda:  Whats your theme again? A Nazi wedding?Carrie:  Id like to think that people have more than one soulmate.Samantha:  I agree! Ive had hundreds.Carrie:  Yeah! And you know what, if you miss one, along comes another one. Like cabs.Charlotte:  I promise I wont become one of those mothers who can only talk about diaper genies.Carrie:  Good.Samantha:  What the hell is a diaper genie?Carrie:  I dont know... someone you hire to change a kids diaper?Samantha:  These fast food apple pies are surprisingly delicious!Carrie:  I know! Why would anybody go to the trouble of making one when you can buy one that is so perfect and individually sized?A performance artist is starving herself and refusing to speak while on public display.Aleksandr:  You dont think its significant?Carrie:  Oh please! There are depressed women all over New York doing the exact same thing as her and not calling it art. I mean, if you put a phone up on that platform, its just a typical Friday night waiting for some guy to call. Samantha:  (on not getting hired because shes a woman)  What does he think Im gonna do? Get my period and ruin his empire?!FBI Agent, to Samantha:  Maam, can you undo your cuffs so we can use ours?Miranda:  He has to get baptized and wear a dress.Carrie:  Babys first drag show!Carrie:  Ooh! I forgot about the washer and dryer! Ive been dreaming about that my whole New York life!Samantha:  Whos the farmer with the dells?Carrie:  Young MacDonald?Samantha:  Oooh! E-I-E-I-O!Guy:  This floors  non smoking!Carrie:  I have an addiction, sir!Carrie:  It was a typical downtown male mix. Ten percent Wall Street, ten percent real estate, and ten percent Samantha had already slept with.Charlotte:  I proposed myself!Carrie:  What?Charlotte:  Yes. I suggested he have a tomato salad, then I suggested we get married.Carrie:  Wait. What exactly did he say?Charlotte:  Alrighty!Carrie:  Alrighty?  He said  alrighty? Now Im thinking the upsetting thing isnt that you proposed, its that you proposed to a guy that says alrighty.Charlotte:  Oh, Carrie, stop!Carrie:  Alrighty. Charlotte:  ...you shouldnt be talking like that at all, Samantha, its rude and politically incorrect.Carrie:  Sweetie, a reminder: Samantha is rude and politically incorrect.Miranda:  Shes an equal opportunity offender.Miranda:  You double-booked?Carrie:  How do you conceive pulling this one off?Charlotte:  Early dinner with bachelor number one, late supper with bachelor number two.Samantha:  My god, youre turning into a man!Carrie voiceover:  Apparently Charlotte had done more than just break a pattern. She had actually changed genders.Charlotte:  I just dont know how Im going to eat two dinners in a row.Carrie voiceover:  And just like that, she was a woman again.Big:  I never really thought about it.Carrie:  Oh come on. Everybody wonders what happens after you die.Big:  Im too busy wondering whos dinging my car in the garage.Carrie:  If you keep talking like that Im going to have to charge you by the minute.Anthony on his cell:  Charlottes wedding dr ess stylist Sorry, thought it was my Mother. FIFTEEN phone calls to make sure I get her the cheapest possible sheets from Bed, Bath and Friggin Beyond! Carrie:  And then I realized something, twenty-something girls are just fabulous, until you see one with the man who broke your heart.Charlotte:  Trey, you have a boner... I cant discuss my notes if you have a boner.