Emerging Markets Essay Example | Topics and Well Written Essays - 2000 words - 1

Emerging Markets - Essay Example While developing economies are usually flooded with emerging markets, the concept is not novel to developed economies. It is these emerging markets, which when successful in the future, become economic giants in the industry (Garten, 1997). The emerging markets need to consider a lot of geographical and economic concerns before setting in a foreign country. They may be small enterprises or large projects. This paper seeks to evaluate the industry of emerging markets in the United States and see how successful it has been over the years. It would also analyze how these emerging markets have affected the economy of US and all related economies. Emerging markets have had positive impacts and some negative setbacks and this paper would state both sides of the picture. The US is the third largest country in the world comprising an area of 3.79 million square miles. It accommodates over 300 million people in fifty states, and being so, it remains the most populated region in the world. The US is the most ethnically diverse nation in the world with people from all over the world staying there for work, study or leisure. It has a GDP of 14.3 trillion US dollars which proves that it is a relatively economically stable country in the world. However, about 11% of the US population lives below the poverty line (Juster, 1997). It has a very high rate of productivity and high rate of scientific developments and innovations. Also, the unemployment level in the US is fairly low and inflation is under control too. The US is bordered by the Pacific and Atlantic Oceans making it a favorable site for water travel. Also, it has sufficient nuclear weaponry and a strong army to ensure its defense against the worldly enemies. The US also enjoys fairly good relations with most economies of the world and it stands as a much unbiased nation with a lot of

Use of cell phones in a workplace Essay Example for Free

Use of cell phones in a workplace Essay The use of mobile phones has become pervasive not only for social interaction but also in the day to day transactions. Tyrone Garage is a business where they are four (4) mechanics that travel around the country to repair customer vehicles 24 hours a day and also travel overseas to buy different car parts. Among the types of repair that Tyrone and his employees perform are tyre change or repair, tyre rotation, brake jobs, oil change , belt change etc . The use of nokia phones allow the mechanics to ommunicate with the garage, so they aware of where they are and can provide them with new customer information. The phones also allow the mechanics to communicate with customers such as getting the customer directions to their location. Although the garage and mechanics will call each other on the same network, the calls to customers will be on different networks. Tyrone Garage has a monthly plan with Digicel which includes 1500 minutes a month to be split between all the mechanics phones and this is used for communication between both the arage and the customers. Tyrone Garage employees use the nokia cell phones to set reminders of appointments that customer would have made. The nokia phones allows you to instantly check appointments you can also install an instant messaging chat whatsapp so you can communicate with an employee, or with the person you intend to meet at any time to confirm, clarify, or alter meeting details (e. g. location, time). This means that if meeting needs to be changed at the last minute, all parties involved can be informed quickly, even if on their way there. Three security features of Nokia phones that are useful to employees of Tyrone Garage are: Remote locking using SMS messages or security code Remote locking allows the device lock to be activated remotely where they will be a timing set on it where it can lock on it own. The end user themselves can do this by sending an sms from another user or sms emulator as long as a remote locking code is predefined in the terminal. Remote locking code can be from 5 to 20 characters or digits. If the device is lost the person who finds the phone still cannot activate any nformation on the phone even if they change the sim card because when they insert the new sim card and turn on the phone that person has to enter a security code before the phone is actually boot up. This feature reduces the risk of the device being stolen and increases the possibility of having the phone returned if misplaced or lost since it has the company label at the back of the phone. Call Barring This feature allows the employer to restrict all international outgoing calls from employees phone

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

The Legacy of Russia and the Soviet Union - Authoritarian and Repressiv

The Legacy of Russia and the Soviet Union - Authoritarian and Repressive Traditions that Refuse to Die There circulated such a Soviet political anecdote: The ghost of Nicolas II visited Brezhnev to inquire about the conditions of his Mother Russia, only to be told that nothing had changed since his reign except for that the vodka was now 20 percent instead of 15. Shocked, the dead czar exclaimed: "I lost my head only for that 5 percent difference?" This was, of course, only a humorous exaggeration, a case of political satire. Yet beneath the humor, there lies a very profound testament to the belief that Russia's political culture has been inherited from its czarist days and manifested throughout its subsequent development. The traditions from the pre-Revolution and pre-1921 Russia, it seems, had left its brand on the 70-years of Communist rule. The Soviet communism system was at once a foreign import from Germany and a Russian creation: "on the one hand it is international and a world phenomenon; on the other hand it is national and Russian†¦it was Russian history which determined its limits and shaped its character." (Berdyaev, "Origin") Historically, Russia has always been a country of perplexing dualities. The reality of Dual Russia, the separation of the official culture from that of the common people, persisted after the Revolution of 1917 and the Civil War. The Czarist Russia was at once modernized and backward: St. Petersburg and Moscow stood as the highly developed industrial centers of the country and two of the capitals of Europe, yet the overwhelming majority of the population were subsistent farms who lived on mir; French was the official language and the elites were highly literate, yet 82% of the populati... ...oved to be singularly influential and daunting. This is, perhaps, the greatest obstacles to achieving true democracy in Russia—the authoritarian and repressive traditions that refuse to die out with the passage of time. Works Cited Berdyaev, Nicolas. The Origin of Russian Communism. London: Saunders, 1937. Cohen, Stephen. Rethinking the Soviet Experience. New York: Oxford University Press, 1986. Fitzpatrick, Sheila. The Russian Revolution. New York: Oxford University Press, 1994. Hosking, Jeoffery. The First Socialist Society. Cambridge: Harvard University Press, 1993. Tucker, Robert C. "The Mortal Danger". Course Reader for World Culture: Russia Since 1917. New York University, Spring 2001. Tucker, Robert C. "Stalinism as Revolution from Above". Stalinism. Edited by Robert C. Tucker. New York: American Council of Learned Societies, 1999.

Khmer Rouge and Stable Communist Environment

How is it that between the Cambodian Genocide and the Holocaust, over eight million people were killed? The similarities and differences between the Cambodian Genocide and the Holocaust are both disturbing yet interesting. To understand how alike and dissimilar these two events are you must consider three things, which are: the cause, courses, and effects. The Cambodian Genocide was lit up by a man named Saloth Sar, better known as Pol Pot. He was a Cambodian Revolutionary as well as the man who created a communist group known greatly as The Khmer Rouge.Pol Pot and Hitler are similar in this way because Hitler also created a political power party known as the Nazis. Both of these leaders were important dictators who created murderous groups. Additionally, this wasn't the only similarity between the two because Pol Pot and hitler both promised something they couldn't back up. Pol Pot promised a stable communist environment , while Hitler promised a big change in their country. Neither of them were actually doing this for the better, but rather for themselves because they both wanted to have absolute power.The difference between the two of them was that Pol Pot had attempted stability and communism by trying to isolate Cambodia, giving the subtle hint that he would rather be somewhat of an underdog and safe, rather than on top and over powerful. In this case, Hitler was the exact opposite. Hitler wanted to be on top; he wanted to be the top dog. He wanted to make Germany a better country but his view and their view were much different. Hitler didn't want to make it better for the less fortunate, he just wanted to make it better for the, already to be know as, higher class.Furthermore, the way Pol Pot and Hitler ran things were very different but in the long run, they both had the same outcome: world wide tragedy for everyone but themselves. During the Cambodian Genocide and the Holocaust, many roles of symbolization came into play. For instance, throughout the Ge nocide everyone was forced to wear black pants and black shirts and in the Holocaust all jews were forced to wear prisoner clothing and of course, the star of david at all times. These weren't the only rules that were very strict.In Cambodia, if you wore glasses you were automatically death sentenced because you were considered to be different and in the Holocaust, you were refrained from wearing shoes. These harsh rules were just the begging of the torture for either countries. Throughout the course of these events, the very serious situations began to occur. In Cambodia, the torture began with labor fields, carried on with starvation and ended with execution but in the Holocaust everything was just thrown at them at once with the death camps and the gas chambers.Nobody can make any exception about not remembering the last step in the Holocaust which was the final solution. Pol Pot and Hitler had very different views on how to carry out the â€Å"organization† of things. Hit ler believed that only very particular people should carry on at the death camps and the rest were thrown into the gas chambers-such as women, child, weak, and certain age groups-. Pol Pot had little stereotypes such as grouping anyone intellectual, wealthy, or high class and they were to be executed together because they were â€Å"different†.The ones that lived through that, had little hope, but still more than the ones going through the Holocaust. One more thing that was similar between the Genocide and the Holocaust was that the population decreased dramatically. In Cambodia, people disappeared daily from camps and the starvation was killing quickly. In Germany, an estimated 4,000 or more jews were killed every single day from either being murdered, freezing, or starving. These deaths were nothing to be taking lightly, yet not enough people took it serious enough.This is one of the reasons both of these events were not stopped until it was too late. The effects of both of these treacherous events were devastating. An estimated 20% of the Cambodian population were murdered throughout four years under the power of the Khmer Rouge. In Germany an estimated six million jews were murdered between the time period of 1933-1945 under the power of Hitler and the Nazis. The punishment wasn't enough for either but at least the Nazis had to go threw the Nuremberg trials.

Evaluate Motivation Theories Essay

Individuals join and work in organizations to fulfill their needs. They are paying attention to organizations that have the means of sustaining their needs. These means are called incentives of rewards; organizations use them to encourage individuals to contribute their efforts toward achieving organizational goals. The continued existence of an organization depends on its ability to interest and encourage individuals to accomplish these organizational and personal goals. Newman (2010), â€Å"Motivation is defined as goal-directed behavior. It concerns the level of effort one exerts in pursuing a goal. Managers are concerned with this concept because it is closely related to employee satisfaction and job performance† (Para. The Concept of Motivation). There are 2 main concepts of theories Maslow’s and Herzberg. Maslow’s need hierarchy theory divides human needs into five levels; self-actualization, esteem, social, safety and physiological needs. Physiological nee ds are the basic human needs including food, clothing, shelter and other necessities of life. Once these are satisfied they no longer motivate the individual. Safety needs include economic security, protection from physical danger. Social needs are love, affection, emotional needs, warmth and friendship. Esteem can be self-esteem, self-respect, self-confidence and recognition. Herzberg found that the factors causing job satisfaction (and presumably motivation) were different from that causing job dissatisfaction. Herzberg called it hygiene factors, using the term â€Å"hygiene† in the sense that they are considered maintenance factors that are necessary to avoid dissatisfaction but that by themselves do not provide satisfaction. Company policy, supervision, relationship with boss, work conditions, salary and relationship are the leading in dissatisfaction. Achievement, recognition, work itself, responsibility, advancement and growth are the leading to satisfaction. The effectiveness of the application of these theories can be measured with observations of employee job satisfaction. Managers can evaluate satisfaction through employee surveys or by observing workers. References: Newman, M. (2010). Motivation. Retrieved from http://business.ezine9.com/motivation-149b57b275.html

Sex and the City TV Show Quotations

Sex and the City TV Show Quotations A perfect play on words, Sex and the City quotes are full of witticisms and unabashed humor.  Here is a refreshing collection of Sex and the City quotes for good coffee-time reading.   Great Quotes From Sex and the City Charlotte: I just know no matter how good I feel about myself, if I see Christy Turlington, I just wanna give up.Miranda: Well I just want to tie her down and force feed her lard, but thats the difference between you and me.Carrie: [to Big] Were so over we need a new word for over.Miranda: Im sorry, if a man is over thirty and single, theres something wrong with him. Its Darwinian. Theyre being weeded out or propagating the species.Detective: You Irish?Miranda: No, why?Detective: Coz you have beautiful red hair.Miranda: Well I guess anybody can be Irish with the right colorist.Carrie: There are 1.3 million single men in New York, 1.8 million single women, and of these more than 3 million people, about 12 think theyre having enough sex.Carrie: I like my money where I can see it - hanging in my closet.Miranda: Whatever happened to aging gracefully?Carrie: It got old.Carrie: When it comes to relationships, maybe we’re all in glass houses, and shouldn’t throw stones. Becaus e you can never really know. Some people are settling down, some are settling and some people refuse to settle for anything less than butterflies. Samanthas terrified to get an AIDS test...Samantha: What if I have it?Carrie: You dont have it.Samantha: Sometimes it takes me a really long time to get over a cold.Carrie: Thats not AIDS, thats central air conditioning.Samantha: Im a try-sexual. Ill try anything once.Miranda: Theyre starting to die on us.Charlotte: Oh my god.Samantha: Well at least you werent stood up.Miranda: 35 and theyre dying. We should just give up now.Carrie: Well, on the bright side, this could explain why they dont call back.Samantha: Hmm.Charlotte: How did he... ?Miranda: Heart attack.Samantha: Oh.Miranda: At the gym.Carrie: See, this is why I dont work out.Miranda: My marriage is going through a rough spot. I dont have time to wax!Samantha: [Upon seeing a firefighter stripper] Hello, 911. Im on fire!Carrie: Maybe some women arent meant to be tamed. Maybe they just need to run free until they find someone just as wild to run with.Mr. Big: Nice dress.Carrie: Meaning?Mr. Big: Nice dress.Carrie: [after hearing Big is moving to Napa, California] If your tired of New York you take a napa, you dont move to Napa! Charlotte: [On seeing the tacky floral arrangement at Mirandas mothers funeral] They were supposed to say Im sorry, I love you not Youre dead, lets disco!.Samantha: [to the girls] I think I have monogamy. I caught it from you.Carrie: Yes, its airborne.Charlotte: I was a teen model when the Ralph Lauren store opened in New Haven.Miranda: Okay, it was amazing that I could keep my lunch down just now.Miranda: Wow! A guy who doesnt want to get married! Film at eleven!Charlotte: So, which church does his mother go to?Carrie: Park Avenue Presbyterian.Charlotte: Good church! Its one of the best on the east side!Carrie: What, are you rating churches? Is there a Zagat guide for that?Miranda: Four stars. Great bread; disappointing wine selection. Carrie:  Now Ive laid down a gauntlet. He either has to say I love you back or I guess Im going to have to break up with him.Charlotte:  Well, how long are you going to give him?Carrie:  Well, I didnt put an expiration date on the sentiment, but I figure its got the shelf life of a dairy product. Its going to start to curdle in about a week.Duncan:  Im just one of those weird male aberrations who  prefers  to be married. I like stability, I like routine. I like knowing  theres  people waiting for me at home. I guess that makes me sound pretty dull.Miranda:  Are you kidding? Youre the heterosexual holy grail.Carrie:  So what type of movies do you compose for?Patrick:  Really bad ones. You know, the I Screamed When I Knew What You Did Last Summer on Elm Street type.Samantha:  You know, women dressing like men is very popular right now.Carrie:  And here I thought it was Pokemon.Steve:  Oh come on, I want a baby. It would be fun.Miranda:  Its not like owning a foosball table, Steve.Aidan:  Dont take this the wrong way but this place could use a little work.Carrie:  I know, but I cant afford it.Aidan:  Youve got eight thousand bucks worth of shoes over there.Carrie:  I needed those! Miranda:  (looking at a bride magazine)  Ooh! Cute purse!Charlotte:  No purses! Theres no time for purses! This is gown-specific!Miranda:  Whats your theme again? A Nazi wedding?Carrie:  Id like to think that people have more than one soulmate.Samantha:  I agree! Ive had hundreds.Carrie:  Yeah! And you know what, if you miss one, along comes another one. Like cabs.Charlotte:  I promise I wont become one of those mothers who can only talk about diaper genies.Carrie:  Good.Samantha:  What the hell is a diaper genie?Carrie:  I dont know... someone you hire to change a kids diaper?Samantha:  These fast food apple pies are surprisingly delicious!Carrie:  I know! Why would anybody go to the trouble of making one when you can buy one that is so perfect and individually sized?A performance artist is starving herself and refusing to speak while on public display.Aleksandr:  You dont think its significant?Carrie:  Oh please! There are depressed women all over New York doing the exact same thing as her and not calling it art. I mean, if you put a phone up on that platform, its just a typical Friday night waiting for some guy to call. Samantha:  (on not getting hired because shes a woman)  What does he think Im gonna do? Get my period and ruin his empire?!FBI Agent, to Samantha:  Maam, can you undo your cuffs so we can use ours?Miranda:  He has to get baptized and wear a dress.Carrie:  Babys first drag show!Carrie:  Ooh! I forgot about the washer and dryer! Ive been dreaming about that my whole New York life!Samantha:  Whos the farmer with the dells?Carrie:  Young MacDonald?Samantha:  Oooh! E-I-E-I-O!Guy:  This floors  non smoking!Carrie:  I have an addiction, sir!Carrie:  It was a typical downtown male mix. Ten percent Wall Street, ten percent real estate, and ten percent Samantha had already slept with.Charlotte:  I proposed myself!Carrie:  What?Charlotte:  Yes. I suggested he have a tomato salad, then I suggested we get married.Carrie:  Wait. What exactly did he say?Charlotte:  Alrighty!Carrie:  Alrighty?  He said  alrighty? Now Im thinking the upsetting thing isnt that you proposed, its that you proposed to a guy that says alrighty.Charlotte:  Oh, Carrie, stop!Carrie:  Alrighty. Charlotte:  ...you shouldnt be talking like that at all, Samantha, its rude and politically incorrect.Carrie:  Sweetie, a reminder: Samantha is rude and politically incorrect.Miranda:  Shes an equal opportunity offender.Miranda:  You double-booked?Carrie:  How do you conceive pulling this one off?Charlotte:  Early dinner with bachelor number one, late supper with bachelor number two.Samantha:  My god, youre turning into a man!Carrie voiceover:  Apparently Charlotte had done more than just break a pattern. She had actually changed genders.Charlotte:  I just dont know how Im going to eat two dinners in a row.Carrie voiceover:  And just like that, she was a woman again.Big:  I never really thought about it.Carrie:  Oh come on. Everybody wonders what happens after you die.Big:  Im too busy wondering whos dinging my car in the garage.Carrie:  If you keep talking like that Im going to have to charge you by the minute.Anthony on his cell:  Charlottes wedding dr ess stylist Sorry, thought it was my Mother. FIFTEEN phone calls to make sure I get her the cheapest possible sheets from Bed, Bath and Friggin Beyond! Carrie:  And then I realized something, twenty-something girls are just fabulous, until you see one with the man who broke your heart.Charlotte:  Trey, you have a boner... I cant discuss my notes if you have a boner.

Export to World

Export to World In art, formalism describes the concept that the artistic merit of a work of art is completely established by its form, its medium, and its visual characteristics[1]. Formalism stresses on the elements of the works of art that include shape, color, texture and line while avoiding concepts of realism such as content and context. In the modern world, visual art has been very prominent.Advertising We will write a custom essay sample on Export to World specifically for you for only $16.05 $11/page Learn More In visual art, formalism denotes a concept that puts forwards that everything required to understand a work of art is enclosed inside the work of art. Formalism is a method of understanding a work of art that reduces the importance of context in a work of art. In this paper, I intend to look at the Export to world project displayed at the Museum of Modern Arts (MoMA) in New York City and located in Ars Electronica in Linz, Austria. Formalism in the modern wo rld has taken a huge leap and focuses on bringing virtual art and object into the real world. Unlike modeling natural objects that utilizes common paths and well-known tools, export to world shows that modeling man-made phenomena can be engaging and quite interesting. Export to the world is an artistic project that seeks to copy virtual objects from second life and export them to real world by converting them into paper craft models[2]. The project was created on behalf of Ars Electronica by Linda Kostowski and Sascha Pohflepp. Export to world aims at investigating the unclear separation between the virtual world and the real world. The project tries to bring to life the design and production of virtual objects into the real world for observation. In export to world, the form of the virtual object is of the main importance. At the shop in Ars Electronica in Linz, buyers can buy purchased or custom-made virtual objects that are exact replicas to those in the second life market. These real life representations of virtual merchandise are exact copies that even contain the flaws inherent in copying. When a buyer purchases a virtual object in Export to world, he is given a two dimensional paper representation of the virtual object which he can physically fit to form a three dimensional real life object on site[3]. In export to world, the real life object is usually forced to correspond point to point to the virtual object. The prominent examples used in Export to world are the Bubble gum machine and the television set.Advertising Looking for essay on art and design? Let's see if we can help you! Get your first paper with 15% OFF Learn More The bubble gum machine in second life contains several objects that are joined to form the final virtual merchandise. The most prominent section is the bubble gum glass container. In Export to world, this container is represented as a sphere embedded with several colors such as orange, yellow, red and blue . These colors give the illusion that the sphere is filled with bubble gum. The sphere is covered on the top by a red plate like object. The plate is not smooth but has rough edges common in most low pixel 3-D pictures. Beneath the sphere is a black vase that is connected to a stand that contains a grey rod fitted to a cylindrical base. All these aspects are transferred into the real world in the Ars Electronica shop. A buyer is provided with a paper representation of the object that can be fitted to form an accurate copy of the virtual object. The â€Å"Export to World† project is a fine example that demonstrates the veil between virtual representation and reality is becoming smaller and smaller. In the past, artistic were trying to represent real objects in the virtual world. Modern formalism has changed this and at the moment virtual art and objects are being copied and represented in the real world. Bibliography Bartholl, Aram. â€Å"Second City.† Ars Electronica. 2007. Web. Kaplan Andreas and Haenlein M. â€Å"Consumer use and business potential of virtual worlds: The case of Second Life†. International Journal on Media Management  11, no. 3 (2009): 1-42. Kostowski, Linda and Sascha Pohflepp. â€Å"Export to world. 2007.† Posting to Museum of  Modern Arts. 2007. Web. Footnotes Andreas, K. and Haenlein M. â€Å"Consumer use and business potential of virtual worlds: The case of Second Life†.  International Journal on Media Management 11, no. 3 (2009): 1-42 Linda K. and Sascha P. â€Å"Export to world. 2007,† Posting to Museum of Modern Arts. Aram B. â€Å"Second City†. Ars Electronica.

Bioethics and Health Care

Introduction: The controversy over water fluoridation in the community arises from moral, ethical, political and security issues related to water fluoridation. As early as 1930 there was an inverse relationship between the fluoride concentration in drinking water and the presence of caries. The use of public water for transporting drugs such as fluorination violates medical ethics. Ethical issues related to water fluoridation include the balance of risks and benefits, the presence of other interventions with the same consequences, and the role of consent. For more than a decade, bioethics and health care professionals have struggled to determine the exact meaning of being medically ineffective. The word waste comes from the Latin futilis. In other words, it is easy to melt. It is a common usage developed from the Greek legend that the daughter of King Arnaus of Argos killed her husband and as a punishment they were forced to gather water permanently in a bucket that leaked water. To reach the empty bucket destination, when the goal is water, provide useless definitions as less or invalid. With the rapid development of medical technology, the work of medical staff is to investigate the resulting ethical dilemma. This is where bioethics works. By applying ethical principles to the medical field, bioethics aims to research and study ways to make decisions on health management. It is a core element to ensure that medical practices and procedures will benefit society as a whole. I explained that the term bioethics was originally introduced in 1971 to refer to a combination of biology, biological science and human knowledge. However, its uses such as clinical decisions, controversial new research, the impact of new technologies, global concerns, public policy, etc. are more widespread today. In fact, bioethics has played a central role in affecting policy changes and laws in recent years. Detailed discussion on current bioethical issues affecting the provision of med ical services. Exploring ethical theory and related principles as a basis for occupational decision making and public policy decision. The course focuses on ethics research process and modern health practices, the relationship between research and education. The historical and comparative analysis of the Western, non-Western, indigenous and indigenous American philosophy includes the essential, aesthetic and utility value of nature and land. We will study modern environmental ethics in detail, such as deep ecology, land ethics, eco feminism, animal rights theory.

My body my laboratory Article Example | Topics and Well Written Essays - 500 words

My body my laboratory - Article Example On the other hand, such self-experimentation allowed the scientifically minded luminaries a firsthand experience that enabled them to directly experience the veracity of what they believed in, thereby allowing for the progress of their cause. In contemporary times such self-experimentation could not be supported and rationalized. Many a time it puts the life of the experimenters at risk. Even if one supports such an approach in the name of altruism, practically speaking there is no need for it. Today, scientific research has entered an entirely new era where not only it is methodically codified and regulated but is supported by state of the art R&D facilities, foolproof methodologies and apt biological, chemical and digital techniques and gadgets that are immaculately sufficient in testing and measuring the nuances associated with varied scientific theories. In a contemporary context, the very need for retaining the sanctity and reliability of scientific research warrants discipline, restraint, and patience. Thus, most of the cases mentioned by Harrell in his article seem to be resorting to such experimentation, more out a lack of patience, inability to defer to established and universally reliable procedures and the need for instant publicity. The usage of one’s body as a laboratory may sometimes yield positive or even groundbreaking results. In the 21st century, scientific research needs more discipline, codification, and scientific reliability, which more than often cannot be furnished by such adventurism.

Managing foreign exchange risk Essay Example | Topics and Well Written Essays - 1750 words

Managing foreign exchange risk - Essay Example This sort of currency disparity amongst the loans of the financial organizations and the assets by which the organizations are funded result in a huge risk where, if at all, the local currency of the nation in which the organization functions reduces against the U.S. Dollar, then the finance organization will be burdened with a substantially huge obligation of liabilities. This paper delineates the efficacious management of Foreign Exchange Risks with regards to hedging. Moreover, we would be able to seek a practical and a prolonging solution to it by applying an affiliation between the private sector and the benevolent communes to quintessentially conquer a chief hurdle which presently holds back the private sector from facilitating risk management assistances to the financial organizations. ... For many years, the South African Development Community has been subjected to poor grain harvests, when the government of both the countries tended to import grains at high prices. Concurrently, the foreign exchange of South Africa witnessed a gradual increment in the trading values of its cereals raising a positive flag for the likelihood of hedging regional import prerequisites (Dana et al, 2006). The hedging of imports can easily be accomplished by means of future contracts and associated financial options. The buying of elongated positions resolves the consequent SAFEX amount basis which construes to the fact that hedging, by bringing into use these instruments alone in unable to defend against the transformations in transport costs and economic costs for the reason that all of them may tend to vacillate widely. This results in a significant element of risk. As a result, the hedging schemes and replication results delineate that hedging by means of various futures or options may appear to increase the import costs with time passing by, which results in reduced inconsistency and likely producing lower standard prices. These advantages augment only if hedging is brought into implementation when domestic prices are at less than the import equivalence and also, if at all the hedge is powered. Nevertheless, there are chances for problems to stay as intra-regional transport prices stay elevated (Dana et al, 2006). A

Pateriarchy and Paternalism Essay Example | Topics and Well Written Essays - 1000 words

Pateriarchy and Paternalism - Essay Example However, by the end of the American Revolution, most states in northern America had already done away with the practice, but in southern states, the institution of slavery was flourishing especially in the large plantations that formed the major economic mainstay of the regions (Allport, 1954, p41). In this respect, Southern states supported slavery while the northern states opposed the practice, resulting to the civil war that was eventually won by the Northern side. For long periods, historians and social researchers have delved on how the slaves related with their masters to ensure that they coexisted peacefully without undue conflicts in such a harsh and dehumanizing working environment. This paper discusses similarities between paternalism and patriarchy in context with slavery practice in the United States. Before discussing the similarities and differences between paternalism and patriarchy, it is important to consider the demographic composition of slaves in both the southern and northern parts of the country and then establish their working conditions. According to Allport (1954, p 47) a slave was a property of a master purchased to provide free and forced labor to the master in the plantations and at homes. Southern states in America and the Caribbean relied heavily on agriculture and large plantations of crops such as sugarcane and tobacco required intensive human labor. To ensure that slaves remained productive at their place of work, the white masters first applied patriarchy during the early periods of slavery and later adopted paternalism in 18th century (Oakes, 2010, 567) Patriarchy was a strict code that emphasized on obedience, discipline, control and severe punishment of the slaves towards their masters (Oakes, 2010, p573). However, patriarchy provided the slaves with protection, guardianship and reciprocal obligation. According to Altemeyer (1988, p 26), patriarchy defined the image of the slave owner and it set the standards of judging slav eholding among the white farmers. The transformation from patriarchy to paternalism in the 18th century was enhanced by the benevolent inclination of the slave-owners towards their black slaves. Consequently, the masters began expecting similar treatment from the slaves and their outlook towards the slaves became more sentimental (Oakes, 2010, p 575). In this regard, the masters tried to create the image of happy and contended slaves, who worked to get protection from their masters. In response to patriarchy, many slaves rebelled against their masters in attempts to resist the work and the harsh treatment. The slaves resisted by feigning sickness, sabotaging, stealing from the masters, arson, destroying tools, mistreating animals among other behaviors. Their resistance was mainly collective, structured to undermine the system in order to facilitate change or validate escape from slavery (Altemeyer, 1988, p 39). This occasionally resulted to revolts that were driven by a common sense of victimization. However, the revolts were not intended to change the structure or the balance of power but provided avenue for expression or execution of retribution directed at an individual but not on the larger system of power (Oakes, 2010, p 583). In this regard, the slaves’ revolts were not revolutionary since they lacked collective

Listeria monocytogenes Research Paper Example | Topics and Well Written Essays - 1000 words

Listeria monocytogenes - Research Paper Example The bacteria also infect animals, particularly ruminants (Low & Donachie, 1997). The name Listeria monocytogenes evolved from different names since 1926. Its former names were Erysipelothrix monocytogenes, Cornybacterium parvulum, Cornybacterium infantesipticum, Bacterium monocytogenes and Bacterium monocytogenes hominin (Uniprot Taxonomy, 2009). The genus Listeria was classified under the Cornebacteriaceae family until 1973. Molecular studies classified it as distinct and the Family Listeriaceae was created within the order Bacillales (Todar, 2009). Listeria contamination can be transmitted through animal feed, manure, mastitic cows, plant and animal products, and through bacterial biofilms. Prevalence of the pathogen in food processing plants is caused by the entry of raw meat and poultry from animals that are infected with Listeria (Dharmarha, 2008). The pathogen can cross to surfaces of floors, sinks, water, equipment, and workers. L. monocytogenes persists with time and contaminate the environment where processing wastes are disposed. Moreover, Listeria is able to survive even under low temperatures. Infected food sold to consumers can cause major outbreaks. Eating contaminated food allows the entry of L. monocytogenes into the digestive system. After ingestion, the immune system of the host is activated and targets the invading bacteria which are engulfed by phagocytes. Phagocytosis is a major response of cell-mediated immunity (CMI), which is mechanism against L. monocytogenes. CMI can be enough to prevent infection, but in cases where the immune system is compromised or weak, as in young children and the elderly, L. monocytogenes can evade the host defense system and cross the intestinal barrier (Dharmarha, 2008). L. monocytogenes is also able to cross the blood-brain barrier and the placental barrier resulting in infection of the brain (encephalitis and meningitis) and the unborn fetus

Red Bull Marketing Questions Essay Example | Topics and Well Written Essays - 1000 words

Red Bull Marketing Questions - Essay Example High income customers have high potential of consumption than low income customers. Therefore, the sales territories will be divided into high sales prospect and low sales prospects. According to the Australian Bureau of Statistics (2012), Australia has a high number of employed people. The employment rate increased by 0.1 percent and this will result to increase in consumer’s consumption. This provides a basis on identifying the sales team territory. The sales territory will be divided into high sales potential and low sales potential territories. The sales team will be allocated roles to seek and increase sales among the income earning people and the unemployment. The income generating individuals constitute the high sales prospects territory while the unemployment make up the low sales territory. Additionally, the sales territory will be determined geographically. The sales team will be allocated responsibilities in different geographical regions. Different sales representatives will be assigned Victoria, New South Wales, Queensland, South Australia, Tasmania, Western Australia, Australian Capital Territory and the Northern territory (Australian Bureau of Statistics, 2012),. In addition, most people living in urban areas have a higher income than the people living in the rural areas. The sales team will be allocated responsibilities in different rural and urban areas. The size of each territory will be determined to decide the number of sales staff to be allocated. This will ensure that the sales representatives are not given too much or too little to do. This can result to over or under servicing of consumers. The sales personnel will be allocated territories appropriately to avoid over servicing of consumers. This can cost the Red Bull since over taxed sales representatives take on suboptimality in their activities. They will take a remarkably small number of leads; spend less time with existing consumers and spot few potential consumers.

Pateriarchy and Paternalism Essay Example | Topics and Well Written Essays - 1000 words

Pateriarchy and Paternalism - Essay Example However, by the end of the American Revolution, most states in northern America had already done away with the practice, but in southern states, the institution of slavery was flourishing especially in the large plantations that formed the major economic mainstay of the regions (Allport, 1954, p41). In this respect, Southern states supported slavery while the northern states opposed the practice, resulting to the civil war that was eventually won by the Northern side. For long periods, historians and social researchers have delved on how the slaves related with their masters to ensure that they coexisted peacefully without undue conflicts in such a harsh and dehumanizing working environment. This paper discusses similarities between paternalism and patriarchy in context with slavery practice in the United States. Before discussing the similarities and differences between paternalism and patriarchy, it is important to consider the demographic composition of slaves in both the southern and northern parts of the country and then establish their working conditions. According to Allport (1954, p 47) a slave was a property of a master purchased to provide free and forced labor to the master in the plantations and at homes. Southern states in America and the Caribbean relied heavily on agriculture and large plantations of crops such as sugarcane and tobacco required intensive human labor. To ensure that slaves remained productive at their place of work, the white masters first applied patriarchy during the early periods of slavery and later adopted paternalism in 18th century (Oakes, 2010, 567) Patriarchy was a strict code that emphasized on obedience, discipline, control and severe punishment of the slaves towards their masters (Oakes, 2010, p573). However, patriarchy provided the slaves with protection, guardianship and reciprocal obligation. According to Altemeyer (1988, p 26), patriarchy defined the image of the slave owner and it set the standards of judging slav eholding among the white farmers. The transformation from patriarchy to paternalism in the 18th century was enhanced by the benevolent inclination of the slave-owners towards their black slaves. Consequently, the masters began expecting similar treatment from the slaves and their outlook towards the slaves became more sentimental (Oakes, 2010, p 575). In this regard, the masters tried to create the image of happy and contended slaves, who worked to get protection from their masters. In response to patriarchy, many slaves rebelled against their masters in attempts to resist the work and the harsh treatment. The slaves resisted by feigning sickness, sabotaging, stealing from the masters, arson, destroying tools, mistreating animals among other behaviors. Their resistance was mainly collective, structured to undermine the system in order to facilitate change or validate escape from slavery (Altemeyer, 1988, p 39). This occasionally resulted to revolts that were driven by a common sense of victimization. However, the revolts were not intended to change the structure or the balance of power but provided avenue for expression or execution of retribution directed at an individual but not on the larger system of power (Oakes, 2010, p 583). In this regard, the slaves’ revolts were not revolutionary since they lacked collective

Red Bull Marketing Questions Essay Example | Topics and Well Written Essays - 1000 words

Red Bull Marketing Questions - Essay Example High income customers have high potential of consumption than low income customers. Therefore, the sales territories will be divided into high sales prospect and low sales prospects. According to the Australian Bureau of Statistics (2012), Australia has a high number of employed people. The employment rate increased by 0.1 percent and this will result to increase in consumer’s consumption. This provides a basis on identifying the sales team territory. The sales territory will be divided into high sales potential and low sales potential territories. The sales team will be allocated roles to seek and increase sales among the income earning people and the unemployment. The income generating individuals constitute the high sales prospects territory while the unemployment make up the low sales territory. Additionally, the sales territory will be determined geographically. The sales team will be allocated responsibilities in different geographical regions. Different sales representatives will be assigned Victoria, New South Wales, Queensland, South Australia, Tasmania, Western Australia, Australian Capital Territory and the Northern territory (Australian Bureau of Statistics, 2012),. In addition, most people living in urban areas have a higher income than the people living in the rural areas. The sales team will be allocated responsibilities in different rural and urban areas. The size of each territory will be determined to decide the number of sales staff to be allocated. This will ensure that the sales representatives are not given too much or too little to do. This can result to over or under servicing of consumers. The sales personnel will be allocated territories appropriately to avoid over servicing of consumers. This can cost the Red Bull since over taxed sales representatives take on suboptimality in their activities. They will take a remarkably small number of leads; spend less time with existing consumers and spot few potential consumers.

Naming the Minerals Essay Example for Free

Naming the Minerals Essay Name the minerals below. Then, insert a percentage of how certain you are in your identification. Finally, explain your percentage of certainty: What was confusing about this mineral? What other minerals do you think it could be? Remember, the minerals in the virtual lab include seven of the following: borax, calcite, corundum, graphite, gypsum, orthoclase feldspar, pyrite, quartz, talc, and topaz. Identification of Mineral Percent Certain Explanation of Certainty Example: Fluorite 80% certain I am almost certain this mineral is fluorite, but I am not completely sure. Fluorite and gypsum are both white, shiny, have white streaks, cleave, and show no reaction to acid. However, the specific gravity of this mineral is 3.18, which is higher than gypsum, so I am pretty sure it is fluorite. Mineral 1: Pyrite 80% certain I am almost sure that this mineral is pyrite because it is gold and has a black streak. The only thinks that do not match up is the specific gravity and the hardness. Mineral 2: Talc 100% certain I am certain that this mineral is talc because the hardness, specific gravity, color, streak and acid reaction are all the same. I am almost sure that this mineral is pyrite because it is gold and has a black streak. The only thinks that do not match up is the specific gravity and the hardness.. Mineral 3:Calcite 100% certain I am certain that this mineral is calcite because it is the only mineral on the list that is white and had an active bubbling acid affect. Mineral 4: Orthoclase Feldspar 90% certain I am almost certain that this mineral is orthoclase feldspar because everything matches but the hardness. The only other mineral it could be is corundum and the hardness is nine and I feel that that is way too high to be my mineral. My mineral matches best with orthoclase feldspar. Mineral 5:Quartz 100% certain I am almost certain that this mineral is quartz because it completely matches the description. Mineral 6: Gypsum 100% certain I am certain that this mineral is gypsum because the color, specific gravity, hardness, streak, luster and cleavage all match up to gypsum Mineral 7:Graphite 90% certain I am almost certain that this mineral is graphite. The only thing that does not match up is the acid reaction. When I ran the test I did not see any reaction with the acid but graphite does react to acid. I did not see any other options because the mineral is black and the streak is brown. So I am almost positive that the mineral is graphite. Part 3: Summary Write a summary answering the following: What are the four requirements for a material to be classified as a mineral? How do you differentiate between minerals? Briefly summarize the six methods to tell minerals apart. Summarize the major differences between minerals and rocks. For a solid to be classified as a mineral it must meet these four requirements: naturally solid, formed by inorganic processes, have characteristics of crystal structure, and a specific chemical composition. In order to tell minerals apart you can use these six methods: luster or color, streak, specific gravity, cleavage fracture, hardness, and acidity. Luster is the intensity that light reflects off of a mineral. A mineral may be shiny, pearly, or even metallic. Some minerals may be distinguishable by their color. By dragging a mineral across a streak plate its mineral powder will leave a streak with a particular color, but this is not a very reliable way of identifying a mineral. By dividing the weight of a mineral in water by the weight of the water you can get the specific gravity of a mineral. Another method is by determining if the mineral has cleavage or fracture. When broken a rock will either be in rounded chunks, fractured, or it be flat with corners, cleavage. Using the M oh’s Hardness Scale you can determine minerals hardness. Hydrochloric acid placed on a mineral will determine whether a mineral contains calcium carbonate. The difference between minerals and rock is that rocks are aggregates. This means a collection of minerals that intergroup together; sometimes many kinds in one rock.

Staphylococcus Aureus: Structure and Functions

Staphylococcus Aureus: Structure and Functions Introduction 1.1 Staphylococcus aureus Staphylococcus aureus is an opportunistic yet versatile pathogen that can infect almost all types of tissue in the human body. 33-50% of healthy individuals were reported to be S. aureus carriers. The diseases resulting from S. aureus infection range from superficial infections; invasive infections such as endocarditis to the life threatening septic shock and toxic shock. The presence of foreign material greatly increases the risk of infection by providing a base for attachment and biofilm formation. S. aureus appears as clustered gram positive cocci under the microscope. Criteria used to identify this organism include the production of golden pigment on nutrient agar; being positive for coagulase; mannitol fermentation and the production of deoxyribonuclease. The virulence of the infecting strain and the nature of the host immune response are important determinants for the outcome of severe S. aureus infection . 1.1.1 S. aureus genome and regulation of gene expression S. aureus has a 2.8-2.9 Mbp circular genome. House-keeping genes and genes associated with central metabolism and some virulence determinants (e.g. protein A) are highly conserved among strains and make up the majority of S. aureus genome. The rest more variable regions mainly consists of mobile elements such as pathogenicity islands (SaPI, 7 identified), genomic islands (ÃŽ ½SaÃŽ ± and ÃŽ ½SaÃŽ ²), Staphylococcal chromosomal cassettes (SCC) and bacteriophages. S. aureus expresses an array of adhesins, immunomodulatory molecules; anti-inflammatory proteins and as many as 30 toxins to invade, evade and cause host tissue damage. Many of the virulence factors discussed below are encoded by genes located in the variable region. Their expression is under the control of a complicated and interconnected regulatory network . Four main gene regulators have been identified, including the two component regulatory system (agr, sae); the transcription factors (SarA and its homologous); the nutrient regulated CodY regulator and alternative transcription factor ÏÆ'B. agr is an auto-inducible quorum-sensing system, promoting expression of extracellular virulence factors and down-regulating cell surface proteins. ÏÆ'B has been shown to participate in the general stress response, and may be involved in antibiotic resistance; pigmentation; biofilm and micro-colony formation (referenced in ). Many surface proteins/adhesin have been shown to be positively influenced by ÏÆ'B, while the expression of most exoproteins and toxins were down-regulated. Activity ofthe agr system is influenced by other gene regulators and may be regulated by cell density. The transcription of agr components were found to be promoted by SarA and gene products of the sar locus and repressed by CodY. To add up the complexity, transcription o f the Sar locus was controlled by three promoters that can be differently activated during in vitro growth. One of these promoters was demonstrated to be ÏÆ'B dependent . It is generally regarded that exponential growth in vitro is correlated with the colonization phase of infection. Correspondingly, genes encoding surface proteins were found to be expressed earlier, starting during the transition from stationary to exponential growth while the expression of secreted proteins started at late-exponential growth phase. The in vivo situation of infection is likely to be more dynamic. Different stimuli trigger combined and coordinated action of the regulatory network, reflecting the particular state of bacterial growth, host defense and environmental nutrition. For example, phagocytosis by neutrophil triggered differential expression of 21.8-39.1% of S. aureus genes â€Å"at any time† following the event. The suppressive effect of CodY on S. aureus virulence factors lead to the possible suggestion that S. aureus may maintain its virulence factor to low level to ‘co-exist harmlessly with the host until a invading opportunity arise. In any case , it would be interesting to see how host immunological activity ‘feedback on S. aureus regulation of its virulence factors, especially immune evasion molecules. 1.1.2 Antibiotic resistance The rapid spreading of antibiotic resistant S. aureus strains through human communities presents a major challenge for conventional treatment. In 2005, it was reported that methicillin-resistant S. aureus (MRSA) infection caused more death than AIDS in USA. S. aureus demonstrated amazing ability to â€Å"co-evolve† with the development of antibiotics. The first generation penicillin uses ÃŽ ²-lactam to bind penicillin-binding proteins (PBP, bacterial transpeptidase) and inhibits bacterial cell wall synthesis. S. aureus resists this class of antibiotics by producing ÃŽ ²-lactamases (aka penicillinase) that cleaves ÃŽ ²-lactam. Second generation of penicillin, such as methicillin was developed. The structure of their ÃŽ ²-lactam has been modified to resist ÃŽ ²-lactamases. S. aureus soon acquired the mecA operon that encodes a modified PBP (PBP 2a), which showed reduced susceptibility for ÃŽ ²-lactam and thus granted resistance to all ÃŽ ²-lactam containing antibiotics. mecA is located on the staphylococcal chromosome cassette mec (SCCmec), a mobile genetic element that allows horizontal transfer of mecA between strains. MRSA infection shows increasing prevalence in all continents, primarily in healthcare-environments (HA-MRSA). Alarmingly, these strains have been shown to exhibit resistance to other types of commonly used non-lactam antibiotics such as ciprofloxacin and erythromycin. Vancomycin, a peptidoglycan polymerization inhibitor, is now considered as the last-line antibiotics for MRSA treatment. However, strains of vancomycin-intermediate S. aureus (VISA) have emerged. Notably, these strains have developed thicker cell walls that require higher concentrations of vancomycin to be effective (minimal inhibitory concentration MIC over 4ug/ml). A vancomycin resistant S. aureus (VRSA) strain has been reported recently (MIC >32 ÃŽ ¼g/ml). This complete resistance is most likely due to the horizontal transfer of the vancomycin resistant gene (VanA) from En terococcus faecalis. Development of effective new antibiotics against S. aureus has met with only limited success, urging the development of alternative therapies based on better understanding of the pathogenicityof S. aureus . 1.2 Adhesin / ECM interaction as key to S. aureus colonization/invasion Colonization is always the first step in bacterial infection and is an important component in pathogenesis. The wide range of tissues that S. aureus can infect reflects its ability to adhere and therefore colonize many different biological niches. S. aureus is now recognized as an invasive organism, targeting non-professional phagocytes such as keratinocytes, epithelial cells, endothelial cells and osteoblasts. The tasks of initial colonization and invasion are assisted by S. aureus surface anchored and secreted adhesive molecules known as MSCRAMM, microbial surface components recognizing adhesive matrix molecules and SERAM, secretable expanded repertoire adhesive molecules. The majority of MSCRAMM and SERAM bind extracellular matrix (ECM) proteins such as fibrinogen and fibronectin. In general, the interaction with ECM proteins is regarded as providing a ‘foothold for S. aureus to establish and to exacerbate infection. However, it has been reported that in some animal models l oss of fibronectin binding proteins (FnBPs) led to an increase in bacterial virulence, indicating a role of the ECM protein in limiting bacterial dissemination or enhancing bacterial clearance. Due to overlap in target specificity; functional redundancy and the difference in experiment settings, the exact contribution of each isolated staphylococcal adhensin protein remains ambiguous. Nevertheless, fibronectin (Fn) and fibrinogen (Fg) are the most popular targets of known S. aureus adhesins. The interaction between FnBPs and Fn is thought to play a key role in S. aureus internalization by non-phagocytic cells, as FnBP-coated latex beads and non-invasive bacteria expressing FnBPs were readily taken into the human cells (293 cells). Internalization provides several benefits for the bacterium: firstly, protection from host serum defense mechanisms and antibiotics ; secondly, access to nutrient-rich environments after escape from phagocytic vessels; thirdly, facilitating the crossing of the endothelial/epithelial layer and spreading of the infection; and lastly, establishing intracellular bacterial reservoirs for recurrent infection. S. aureus produces two related FnBPs (namely A and B) that contain almost identical Fn-binding domains in the close proximity to their cell-wall-spanning domain. The Fn-binding repeats of FnBPA were crystallized in complex with the N-terminal F1 modules of Fn. FnBPA peptide is inserted along the triple-stranded ÃŽ ² sheets of the Fn F1 module to form an antiparallel tandem ÃŽ ² zipper. Since the C-terminus of Fn interacts with ÃŽ ±5ÃŽ ²1 integrin that are expressed on most host cell surfaces, S. aureus can attach to the host cell through a Fn bridge. The attachment was shown to trigger the accumulation of actin and focal-contact-associated proteins (e.g. tensin) at the bacteria contact site and initiate internalization in a protein tyrosin kinase FAK-dependent manner. It was predicted that one FnBP can bind six to nine Fn molecules. This multivalent interaction was suggested to be important in mediating internalization . The bindings of Fg by the clumping factors (ClfA and ClfB) and FnBPA are mediated by a shared protein structure called the A domain and by a â€Å"dock, lock and latch† mechanism. Interestingly, Clf A is expressed during stationary phase and binds to the ÃŽ ³ chain of Fg. ClfB is expressed at the exponential growth phase and binds to the C-terminus of Fg AÃŽ ± chain. This portion of Fg has been reported to be involved in the coagulation process and wound healing . Fn and Fg interactions have been blamed particularly in S. aureus wound infection and infective endocarditis in humans. Fg binding alone could initiate experimental endocarditis in mice and has been correlated with valve colonization. However, cell invasion and persistence of the infection only occurred when the Fn-binding ability was enabled (via FnBPs). Both interactions were statistically correlated to disease severity. Binding to Fg and Fn simultaneously significantly accelerated the rate of internalization into cultured endothelial cells. In this regard FnBPA that is capable of binding both proteins may play an important role in establishing endocarditis . Platelets accumulation on the heart valve is another critical factor for the development of infective endocarditis. S. aureus-induced platelet aggregation is a complicated and multifactorial process and was suggested to be dependent on Fg or fibrin. FnBPA, ClfA, ClfB and SdrE (serine-aspartate repeat protein) were shown to be able to cause platelet aggregation independently of other S. aureus surface proteins. ClfA displayed the strongest aggregation effect among the last three. SdrE required the presence of plasma to cause aggregation, although the mediator was not identified. ClfA was proposed to interact with platelet indirectly through an Fg bridge or directly with platelet surface protein p118. Other studies have argued that ClfA-specific IgG also participated in platelet activation by cross-linking ClfA to platelet FcÃŽ ³RIIa receptor . 1.3 S. aureus toxinsdirect damage of host cells S. aureus produces a range of cytotoxins, including the ÃŽ ² barrel pore forming toxin (e.g. ÃŽ ± hemolysin); the two component pore forming leukocidins and the exfoliative toxin. Besides the effects of reducing viable phagocytes and weakening host immune system, S. aureus cytotoxins are currently believed to contribute to bacterial dissemination. Lysis of host cells might also provide nutrients for proliferating bacteria, especially iron from hemolysis . These toxins have different prevalence in different diseases. Exfoliative toxin (ET) operates at the epidermal layer of the skin and causes staphylococcal scalded-skin syndrome. ET-A acts as serine protease and specifically cleaves Desmoglian-1 (Dsg-1). Dsg-1 is a cell-cell adhesion molecule expressed on epidermal keratinocytes. Cleavage of Dsg-1 disrupts the superficial layer of epidermis and helps bacterial invasion. ÃŽ ±-hemolysin (Hla) is strongly implicated in S. aureus lung infections. Active and passive immunization of Hla strongly protected mice against S. aureus pneumonia. Hla is released as a water soluble monomer and oligomerises on the host cell membrane to insert the hydrophobic stem domains. Seven Hla monomers are required to form a pore which eventually leads to cell lysis. At sub-lethal concentrations of Hla, host cells produce pro-inflammatory cytokines like IL-8; IL-6; vasoregulators (PGI2, PGE2 and thromboxane), which could have detrimental systemic effect. The exp ression of twenty S. aureus virulence factors were disrupted individually or in combination and the virulence of the resultant deletion mutants were compared in a mice pneumonia model. Deletion of argA, which encodes a component of the arg gene regulation system, resulted in almost complete loss of virulence. Only the Hla deletion mutant produced comparable effects, indicating the importance of Hla in causing lung tissue damage. Human neutrophils can resist Hla lysis but these cells are targeted by Leukocidins. Leukocidins are thought to act in the similar way as Hla. Among the leukocidins, Panton-valentine leukocidin (PVL) is found in all CA-MRSA (community acquired-MRSA) isolates and strongly associated with CA-MRSA infection. However in mouse models of abscess, sepsis, and pneumonia, the severity of diseases caused by PVL- deletion strains were not significantly different from that caused by the wt strains. More surprisingly, PVL-expressing S. aureus strains did not lyse human ne utrophils better than that without PVL. However, it is not clear how these experimental conditions resemble the amount and time of PVL production during infection in human. Another significant problem is that PVL might be human specific and might not work in mice. Nevertheless, a new class of leukocidal molecules, the ÃŽ ± type phenol-soluble modulin (PSMÃŽ ±), was produced at a considerably high level by CA-MRSA. They were shown to contribute to the increased neutrophil lysis, skin lesion formation and mortality rate of experimental animals caused by CA-MRSA infection . 1.4 Interaction of S. aureus with host immune system 1.4.1 Brief overview of host defense against S. aureus Host defense against S. aureus mainly relies on the innate immune system, in particular, neutrophil mediated killing. The integrity of skin and mucosal layer is the first line of defense against invading bacteria. They also encounter antimicrobial substances released by epithelial cells and phagocytes (e.g. defensins; cathelicidins and lysosome). Defensins and cathelicidin are positively charged antimicrobial peptides that could permeate the bacterial membrane. Lysozyme is produced by many cell types and secreted into various tissues. It cleaves bacterial cell wall peptidoglycan at ÃŽ ² 1-4 glycosidic linkage between N-acetylmuramic acid (NAM) and N-acetylglucosamine (NAG). Innate pattern recognition receptors (e.g. Toll-like receptor 2) and immunoglobulin also detect the presence of S. aureus. The latter is recognized by C1q and initiates the complement classical pathway (CP) or directly activates phagocytosis through Fc receptor expressed on neutrophils or monocytes. The human comp lement system is discussed in more detail below. One outcome of complement activation is the production of anaphylatoxin C3a and C5a. Together with formyl methionine peptides produced by bacteria, these chemoattractants are sensed by their receptors expressed on leukocytes and attract leukocytes to the sites of infection. Leukocyte recruitment is accomplished through highly coordinated interactions between adhesins on leukocytes and endothelial cells. Leukocytes change from rolling in the blood stream to firm adhesion to the endothelium and then transmigrate through the endothelial layer. Subsequent migration of leukocytes to infection sites is mediated by integrin interacting with ECM proteins. Once they reach the infection site, the phagocytes recognize antibodies or complement fragments deposited on the bacterial surface through their respective receptors. Phagocytosis then occurs. The phagosome is fused to the lysosome to form the phagolysosome for enzyme-mediated and oxygen fre e radical mediated destruction . 1.4.2 The human complement system The human complement system is a sequentially activated proteolytic cascade that involves more than 30 fluid phase and surface bound proteins. It is one of the key elements of the innate immune system that connects bacterial recognition, leukocyte chemotaxis; phagocytosis as well as adaptive immunity . Three main activation pathways are utilized to recognize foreign and danger signals. The classical pathway (CP) senses antigen bound antibody by C1q. Bacterial carbohydrate ligand is recognized by mannose binding lectin (MBL) or ficolins and initiates the lectin pathway (LP). Upon ligand recognition, both pathways use their specific proteases to cleave C4 and then C2. The resultant C4b2a (the C3 convertase) converts C3 to C3a and C3b. The Alternative pathway (AP) starts by direct binding of C3b to the bacterial surface generated by spontaneous lysis of C3 to C3b called â€Å"tick-over†. Factor B that associates with surface-bound C3b is subsequently cleaved to Bb and forms the alternative pathway C3 convertase C3bBb. The amplification loop of C3 activation is started. C3 cleavage is the central event and merging point in the three pathways. Accumulation of surface bound C3b changes the substrate specificity of C3 convertase to C5. C5 cleavage produces C5a and C5b. The latter m ediates the formation of the membrane attack complex C5b-9 (MAC), which inserts into the target cell membrane and ultimately causes lysis of target cells. C3a and C5a are powerful anaphylotoxin that trigger neutrophil homing. The overall picture of this complex system is depicted in Fig. 1.1 MASP: mannose-binding lectin–associated serine proteases. Figure adapted from Walport et al 2001 (Ref.). Three main outcomes of complement activation are: 1, chemotaxis of leukocytes via C5a and C3a; 2, C3b mediated phagocytosis via complement receptors on phagocytes; and 3, lysis of bacteria by MAC. It is also suggested by recent studies that the C3b presented on bacterial surface are critical factors for B cell activation and the production of specific antibodies. Although the MAC complex cannot function on gram positive bacteria like S. aureus, leukocytes mediated killing is critical for fighting against S. aureus infection . 1.4.3 S. aureus Immune evasion molecules 1.4.3.1 Resistance to antimicrobial substances S. aureus circumvents antimicrobial substances by three main strategies: 1, changing surface charges; 2, modifying the substrates of antimicrobial substances and 3, inactivating antimicrobial substances. S. aureus employs two enzymes to change the highly negatively charged teichoic acid in its cell wall (WTA). DltABCD (Dlt operon) adds D-alanine to WTA and the multiple peptide resistance factor F (Mprf) participates in the modification of membrane phosphatidylglycerol with L-lysine. Both modifications increase bacterial surface charges and thus reduce the attraction to the cationic defensins. dlt or MprF defective strains were killed more efficiently by neutrophil oxygen-independent killing. The former was much less able to cause arthritis and mortality in mice sepsis and arthritis models . S. aureus avoids lysozyme cell wall cleavage by modifying its cell wall peptidoglycan. O-acetyltransferase (OatA) was proposed to mediate this response. OatA catalyses the acetylation of muramic acid, which results in the addition of an acetyl group on S. aureus peptidoglycan. An oatA- strain was sensitive to lysozyme, while complementary expression of the enzyme restored its resistance . Two enzymes have been reported to directly inactivate antimicrobial peptides. Aureolysin (a metalloproteinase) could cleave and therefore inactivate cathelicidin LL-37. Staphylokinase (SAK), a secreted plasminogen binding protein, was reported to form a complex with ÃŽ ± defensin and almost completely blocked its antimicrobial activity. This activity was independent of plasminogen binding. S. aureus strains that produce SAK had a higher survival rate in vitro and higher virulence in a mouse arthritis model . 1.4.3.2 Prevent phagocytosis and opsonision 1.4.3.2.1 General anti-opsonin molecules S. aureus clinical isolates produce a capsular polysaccharide outer cell wall. Serotypes 5 and 8 of the capsular polysaccharide are associated with increased virulence. The capsule is anti-opsonic via blocking of surface deposition of opsonins and their receptor/ligand interaction. Immunoglobulins are targeted by protein A (SpA) and its homologues Sbi (S. aureus IgG-binding protein), SSL7 (Staphylococcal superantigen-like protein 7) and SAK. SpAis a 42 kDa surface anchored molecule. It has four to five IgG binding units that could interact with IgG Fc portion. This interaction presents IgG to leukocytes Fc receptor in the wrong orientation and therefore prevents recognition. In the present of IgG, strains expressing high level of SpA were shown to be more resistant to leukocyte phagocytosis than SpA-poor strains, especially when the sole source of opsonin was purified IgG. Opposite results occurred with IgG-deficient serum, indicating SpA confers protection against neutrophil through IgG interaction. Sbi contains two IgG binding sites at the N-terminal domain. The significance of the Sbi/IgG interaction remains to be fully established. SAK forms a complex with plasminogen and converts plasminogen to plasmin. Plasmin cleaves IgG and C3b deposited on S. aureus resulting in reduced recognition by phagocytes and likely impaired initiation of C1q mediated CP activation . 1.4.3.3 Complement inhibition S. aureus is now recognized as ‘a master of complement evasion. Unlike other bacteria which use host factors to ‘disguise the bacteria or inhibit complement activation, S. aureus produces a group of proteins to attack the key elements of the complement cascades. The list of anti-complement virulence factors is growing. So far, five complement inhibitors have been demonstrated and well characterized: SCIN; Efb; Ehp; SSL7 and Sbi. Interestingly, SCIN, Efb, Ehp and Sbi all use a triple ÃŽ ± helix bundle as their functional domain while their modes of action are markedly different (Fig. 1.2). SSL7 belongs to the SSL protein family. Its function will be discussed in context with other members of the family in a later section. 1.4.3.3.1 SCIN SCIN (staphylococcal complement inhibitor) is a human-specific 9.8 kDa secreted protein with a trip ÃŽ ± helix structure (Fig. 1.2) and is produced by 90% of S. aureus strains. SCIN was shown to inhibit all three complement activation pathways. In the presence of SCIN, the deposition of C3b and MAC were prevented, so was the C2b and Ba release. However the amount of surface bound C3 convertases (both forms) were increased, suggesting SCIN had a stabilizing effect on this complex. SCIN bound to surface-immobilized C3b directly and the binding site was predicted to involve the C3b MG7 and MG8 domain and the area nearby. This was confirmed by the co-crystallized SCIN-C3bBb complex. In vitro binding studies suggested the complex was likely to form in a 1:1 or 2:2 ratio. Indeed in the crystal structure, the complex appeared as a SCIN2C3b2Bb2 heterodimer that was bridged by the two SCIN molecules cross-linking the two C3b fragments. However this cross-linkage was not critical in SCIN compl ement inhibition as monomeric interaction also resulted in stable and inhibited C3 convertase. Native C3 could still associate with the SCIN-C3 convertase complex, but the production of C3b was largely inhibited, suggesting the convertase was likely trapped in a dysfunctional yet stable state by SCIN. Moreover, SCIN exerted a partial competition for factor B binding to C3b and a complete competition for factor H/C3b binding. The significance of the inhibition on factor H was not clear although reducing iC3b (inactive product of the cleavage of C3b) mediated downstream signaling could be beneficial for the bacterium. Physiologically, C3 convertase decays shortly after assembly. This disassociation is required for further cleavage of C2 and factor B. Thus SCIN functions by preventing C3 convertase decay; hindering conformational activation of C3 convertase and possibly by blocking C3b/iC3b mediated signaling . 1.4.3.3.2 Efb Efb (extracellular fibrinogen-binding protein) and the recently discovered Ehp (Efb-homologous protein aka Ecb) have been shown to inhibit C3b deposition in AP and C5 convertase activity in all three pathways. The efb gene is present in 85% of S. aureus isolates sequenced to date. Its inhibitory effects on complement mediated lysis and neutrophil activation in response to C5a have been demonstrated. The Efb complement binding domain (Efb-c) is also a triple ÃŽ ± helix huddle, although the arrangement is different from SCIN (Fig.1.2). It binds both C3 and C3b via the C3d fragment. However, which of the C3 forms is the primary target of Efb is debated. Structural-biochemical analysis suggested the binding affinity of Efb-C to native C3 was higher than that to C3b. The binding was proposed to induce conformational changes in C3 and prevent proper cleavage of the molecule. This view was challenged by Jongerius et al based on the observation that C3 cleavage was not influenced by Efb-C in CP/LP. Instead, they suggested Efb-C attacked complement intermediates that contain C3b. Therefore, in CP/LP, C3 convertase (C4b2a) was not affected by Efb but C5 convertase (C4b2aC3b) was inhibited, as evidenced by the decreased C5a production. Ehp was found to contain two C3d binding sites and showed higher levels of inhibition compared to Efb, though the mechanism of action was proposed to be similar. Nevertheless, the C3d fragment carries another important task: mediating interaction with complement receptor 2 (CR2) on B cells and facilitating B cell activation. Both Efb-C and Ehp were shown to completely inhibit C3d:CR2 interaction and its stimulatory effect on a B lymphoma cell line. The predicted binding site of CR2 on C3d was in close proximity to the residues that have been shown to be involved in Efb-C:C3d and Ehp:C3d binding. The exact competition mechanism remains to be confirmed . 1.4.3.3.3 Sbi Sbi is another secreted S. aureus protein that targets C3 activation. Sbi binds C3b but has a stronger affinity to C3dg. The binding was shown to be improved when the C3a domain was also present. These observations suggested the C3dg and C3a portion of C3 were important for Sbi/C3 interaction. By comparing binding profiles of different domains of Sbi, the C3 binding site was proposed to be located in its fourth domain (Sib IV). Interestingly, Sbi IV alone inhibited AP activation in a dose-dependent manner. However when the third domain was also present, incubation of human serum with this recombinant protein induced activation of complement, as shown by the degradation of native C3. A distinctive C3 derivative was present in Sbi-III-IV treated serum, whose molecular weight and migration behavior on two dimensional SDS-PAGE correspond to a transacylation product of C3b and Sbi. The cleavage of C3 activates an internal thioester moiety in the C3b fragment, which allows C3b to form cova lent bonds with hydroxyl groups in close proximity (e.g. bacterial surface). Thus it was proposed the Sbi III-IV provided a fluid-phase transacylation target for C3 cleavage and cause non-effective activation of the alternative pathway. Since mutational study confirmed the Sbi-IV was responsible for the complement inhibitiory effect, Sbi-III was proposed to be important in consumptive complement activation. Once again, Sbi IV adopts the triple helix structure, arranged in a similar fashion as Efb-c and Ehp (Fig. 1.2). Just like Efb and Ehp, the binding of C3dg to CR2 was inhibited by Sbi-III-IV, implying that Sbi may also influence adaptive immunity . 1.4.3.4 Preventing phagocyte extravasation and chemotaxis 1.4.3.4.1 CHIPS; FLIPr and FLIPr-like CHIPS (the chemotaxis inhibitory protein of S. aureus) was identified for its ability to prevent neutrophil chemotaxis to formylated peptide and C5a. CHIPS encodes a 121-amino acids (aa) secreted protein and presents in 62% of S. aureus clinical isolates. Postma et al demonstrated that CHIPS selectively and directly bound to C5a receptor (C5aR) and formylated peptide receptor (FPR) expressed on cell surface and competed with their respective ligands for binding. Receptor activation, as measured by the Ca2+ influx and murine neutrophil migration to the injury site, was inhibited. The two receptors were shown to interact with different areas on CHIPS. The N-terminal 6 residues of CHIPS, F1 and F3 in particular, were identified as the FPR binding sites. While the C5aR-binding domain was mapped to residues 31-121, which forms a packed structure similar to the ÃŽ ² grasp domain. Arginine 44 and lysine 95 were shown to be critical for its antagonizing activity. C5aR binds CHIPS through its N-terminus residues 10-18. These residues were suggested to be either involved directly in C5a binding or were required to stabilize the interaction. Therefore, CHIPS may function by direct competing with C5a or by disrupting the formation of the stable ligand/receptor complex . Two more S. aureus proteins were found to inhibit neutrophil chemotaxis. The secreted FPR-like 1 inhibitory protein (FLIPr) and its homologue FLIPr-like bound FPR and FPR-like 1 receptor (FPRL1). The N-terminal 6 residues of both proteins were important in both interactions but the phenylalanine was not critical for FRP binding. The inhibition of FPRL-1 by both proteins occurred in the nanomolar range. FLIPr-like was shown to be a potent inhibitor for FPR with activity comparable to CHIPS. However, animal infection models with chips or flipr isogenic deletion strains has not been reported. The contribution of CHIPS in bacterial infection is yet to be determined . 1.4.3.4.2 Map Map (MHC class II analog protein a.k.a. Eap) is a multifunctional 60-70 kDa secreted protein expressed by 97% of S. aureus isolates. It is an anti-inflammatory molecule that reduces leukocyte availability and function. Map can interact with a wide range of host ligands, including Fg, Fn and ICAM-1 (intercellular adhesion molecule-1). Map largely blocked ICAM-1 mediated firm adhesion and transmigration of neutrophil. In a peritonitis mice model, intraperitoneal injection of Map or pre-treatment of mice with Map showed 50-75% inhibition of neutrophil recruitment. Neutrophil infiltration in mice infected with a map- strain was 2-3 folds higher than that seen with a map+ strain, demonstrating Map inhibits ICAM-1 mediated neutrophil migration in vivo. Interaction of Map with ICAM-1 may modify signal transduction in leukocytes. NF-ÃŽ ºB activation and tissue factor release in THP-1 cells were diminished by Map treatment. A substantial amount of IL-6 and TNF-ÃŽ ± and a smaller amount of IL- 4 were released from Map treated human CD14+ PBMC in vitro. Anti-ICAM-1 antibody blocked the action, suggesting the induction was also mediated by ICAM-1. It is not clear if cellular processes other than cytokine production are also influenced, although Maps effect on PBMCs appears to be dose dependent . In addition to the cytokine changes, T cell function was impaired by Map. Mice treated with Map showed significantly reduced T cell mediated delayed-type hypersensitivity (DTH) and T cell proliferation. Adoptive transfer of T cells from Map-treated mice to untreated recipients prevented the recipients from developing DTH when challenged with allergen. The Map

The Colonies of Culture:The Postcolonial Self in Latin America and Afri

The Colonies of Culture:The Postcolonial Self in Latin America and Africa The colony is not only a possibility in the geographical; it is a mental dominance that can imperialize the entire self. Entire continents have be domineered, resources completely dried, and at colonialism’s usual worst, the mental devastation of the indigenous culture has left a people hollow. Indigenous culture is no longer that. In the globalized world, no culture is autonomous; culture cannot breathe without new ideas and new perspectives, perspectives that have traditionally come from the people who have lived within the culture. But, the imposition of dominant cultures has certainly benefited from culture’s own vulnerability, as global similarities now exist throughout most different, yet not separate cultures. Postcolonialism is imperialism with a mask on, nothing less. As Franz Fanon puts it â€Å"that imperialism which today is fighting against a s true liberation of mankind leaves in its wake here and there tinctures of decay which we must search out and mercilessly expel from our land and our spirits.† Postcolonial power is a hidden monster, it still do this day dominates the economies and pyschologies of Latin America and Africa. This has led to violence, both guerilla and dictator violence, and this violence is an unforgettable part of the past of African and Latin American culture. Culture and the self exist symbiotically, one cannot exist without the other. Culture is the all encompassing social-structure of a given society. It is the child of people, a child that grows to adulthood quickly, and begins to control its parents molding of itself, it encompasses those who create it. Culture is fluid. Violence is an essential part o... ... has been labeled â€Å"terroristic†, yet this was completely overshadowed by the colonial government and vigilantes killing over 11,000 suspected rebels. The Mau Mau movement and the heavyhanded response helped to bring an end to British rule, but when Kenya was granted independence, Mau Mau had nothing to do with it. The poor people of Kenya were terrified as the government responded to the Mau Mau movement, the armed forces didn’t know where to attack, so they used terrorist tactics in response, murdering whoever they could find, destroying entire villages, in order to stop the Mau Mau. These culture of violence created a self in fear, a self that has been trained that it is under attack. The self of the indigenous person has been enslaved, labored, tortured and murdered, all due to the violent power colonialism and postcolonialism spread throughout the world.

Ghost Story of Vietnam Veteran Haunting Lakewood, Ohio Essay -- Urban

Vietnam Veteran Haunting Lakewood, Ohio Perhaps some of the best stories told are classified as urban legends. Urban legends have become a part of culture, and a way to tell stories. They can tell us things about ourselves and about how we lead our lives. They serve to entertain us, but can also teach us lessons, such as morals to live by. Urban legends are passed on between generations, and become a part of the oral history of a place. Whether the stories are true or not, urban legends are often taken to hold at least some truth about a culture. No matter how radical some of the stories may be, people often take the urban legends to be true. People may take these stories to be true simply for entertainment purposes, but mostly because the morals the stories teach are important. Urban legends can become a part of the place where they originate, and can help define a culture, and shape its history. There a number of urban legends from where I live in Cleveland, Ohio, but one struck me more than others. The man who told me the story had attended the same high school as I, St. Edward High School, an all-boy high school, in Lakewood, Ohio. Lakewood, Ohio is a suburb of Cleveland located directly on Lake Erie. It is a small town that does appear to have anything special about it. It was very hard to find an urban legend concerning this small town where I attended high school, but my friend’s father knew the perfect story. He was born and grew up in Lakewood, and so knew the area very well. He had not heard the legend before attending St. Edward, but heard it during his first week of high school. After that, the story became so common, that it did not seem weird to him. The students of the school simply seemed to acc... ...am Vet from Lakewood became a famous story not only in the halls of St. Edward, but throughout the city of Lakewood. With the ghost of the vet haunting Lakewood Park, the entire city was haunted by the tale, with sightings of the ghost being made by many different citizens. However, the story is special to St. Edward because it is believed that the vet who committed suicide attended St. Edward High School before going to war. Urban Legends help to tell a history and share a culture with those who listen to them. The Legend of the Vietnam War Vet did just this. The story was easily relatable to kids of the area, as most kids either attended Lakewood High School or St. Edward. The story of the Vietnam Vet from Lakewood is one that has served to create a culture for Lakewood, Ohio, and is one which will live on in the city, and the halls of St. Edward High School.