Using the Spanish Verb Salir

Although salir is a very common verb that means to leave in the sense of to depart or to go out, it also has a variety of other meanings that may not immediately be obvious. Fast Facts Salir is a common verb that most often means to leave or to exit.In some contexts, salir can have other meanings that generally refer to the change in status, appearance, or location of someone or something as the result of an action.Salir is conjugated irregularly. Salir Meaning 'To Leave' Here are some examples of sentences with salirs most common meaning: Los Cubs salieron de Los à ngeles con una victoria. (The Cubs left Los Angeles with a victory.) ¿Cuà ¡ndo saliste por primera vez de tu casa con tu bebà ©? (When did you leave home for the first time with your baby?)Mi avià ³n sale a las nueve con destino a Tijuana. (My plane leaves at 9 for Tijuana.)Voy a salir a comprar leche. (Im going out to buy milk.)Propongo que salgamos a la calle a celebrar el campeonato. (I suggest we go out to the street to celebrate the championship.)Saldrà © muy motivado pero sà © que no serà ¡ fà ¡cil. (I will leave very motivated, but I know it wont be easy.) Salir With Other Meanings Here are some other meanings of salir with sample sentences: to turn out: Me salià ³ bien la prueba. (The quiz turned out well for me.) Salà ­ enoja en la foto. (I turned out looking angry in the photo.)to appear (often said of a bodily condition): Me sale pus de los pendientes. (Im getting pus from my earrings.) Si lo tocas te saldrà ¡ urticaria. (If you touch it youll break out in hives.)to rise (said of astronomical bodies): El sol sale hoy a las 7:12. (The sun rises today at 7:12.)to be published or disseminated: Estaba viendo el televisor cuando salià ³ las noticias de lo que habà ­a pasado en Nueva York. (I was watching the television when they told the news of what had happened in New York.) El libro salià ³ a la venta en los primeros dà ­as de noviembre. (The book went on sale in the first days of November.) In a negative form with an indirect object, salir can indicate the inability to accomplish something: No le salià ³ como esperaba. (It didnt turn out as he hoped.) No me sale este problemita de distancia entre 2 puntos. (I cant figure out this simple problem about the distance between two points.) In the reflexive form, salirse sometimes refers to some type of overflowing or leak: Pese a que hace seis meses se crearon las nuevas canalizaciones, el agua se salà ­a inundando las calles. (Despite it being six months since the new pipes were installed, the water leaked, flooding the streets.) The phrase salirse con la suya usually means to get ones way: Chà ¡vez se salià ³ con la suya y Coca-Cola retirà ³ el producto de la venta. (Chavez got his way and Coca-Cola took the product off the market.) Salir can also be a part of some common phrases: salir con (to go out with) — Teresa sale con Josà ©. (Teresa is going out with Jose.)salir de (to come from) — La leche es un alimento que sale de las vacas. (Milk is a food that comes from cows. Salir de more commonly means to leave or to exit.)salir caro (to be expensive): Sale muy caro deportar indocumentados. (It is very costly to deport undocumented people.) As always with words that have more than one meaning, pay attention to context in order to determine what is meant. Related Words La salida is a common noun with meanings related to those of salir. They include an exit or way out, the solution to a problem, a departure, the rising of the sun (or other astronomical body) and various kinds of output. The adjective salido can refer to something that is bulging or protruding. It can also refer to an animal in heat (or the human equivalent). The adjective saliente can refer to someone or something thats important or prominent, or to a politician who is leaving office. Conjugation of Salir Salir is often regular, but it adds a g to the stem in some forms and also modifies the ending in the indicative future and conditional tenses. Here are the irregular forms: Present indicative: yo salgo Future indicative: yo saldrà ©, tà º saldrà ¡s, à ©l/ella/usted saldrà ¡, nosotros/nosotras saldrà ­amos, vosotros/nosotras saldrà ©is, ellos/ellas/ustedes saldrà ¡n Conditional: yo saldrà ­a, tà º saldrà ­as, à ©l/ella/usted saldrà ­a, nosotros/nosotras saldrà ­amos, vosotros/nosotras saldrà ­ais, ellos/ellas/ustedes saldrà ­Ãƒ ¡n Present subjunctive: yo salga, tà º salgas, à ©l/ella/usted salga, nosotros/nosotras salgamos, vosotros/nosotras salgà ¡is, ellos/ellas/ustedes salgan Affirmative imperative: sal tà º, salga usted, salgamos nosotros/nosotras, salgan ustedes Negative imperative: no salgas tà º, no salga usted, no salgamos nosotros/nosotras, no salgà ¡is vosotros/vosotras, no salgan ustedes.

What Gross Domestic Product ( Gdp ) Is A Better Life Essay

HoChun Lam Professor Robert Horito ECON-2010-380 October 31, 2015 Life Quality and Economy Most people may know what gross domestic product (GDP) is. And most people think that if a country has a high GDP, it tells us the country is strong. High GDP countries’ people have higher salary, higher material life, and more economic activity. However, it does not mean that high GDP countries’ people have a better life. For example, most of high GDP countries have serious pollution problem. Therefore, they have to spend a lot of money on health care. Do they really have a better life? Also, GDP has advantages and disadvantages. GDP is only one of the methods to evaluate the quality of countries. One of the disadvantages of GDP is not comprehensive. Working is not only can be occurred in workplace. Workers can also work at home, like housekeeping and child care. And GDP would not count this type of job. However, they actually can develop the economic income. Moreover, a country can have really high GDP with only making a lot of production, but people who living in this country can be really poor. Also, the cost of natural disasters can increase GDP. However, is natural disaster a good thing? The answer is no for sure. The GDP would not show the impact of the environment. It only consider the positive side; therefore, it can tell GDP is not objective enough. On the other hand, I will explain the advantages of GDP as a measure of welfare. GDP is the total value of goods andShow MoreRelatedComparing The Australian Economy And The Chinese Economy1066 Words   |  5 Pagestechnologies, economic health, and the creation of an overall better quality of life. The comparison between the Australian economy and the Chinese economy provide a detailed and comprehensive view of both nations. China is of political, cultural and economic strategic importance to Australia. Economic growth, employment/unemployment, environmental sustainability, the role of government (in health care, education and welfare), and quality of life determine the economic development of a nation. AustraliaRead MoreThe Canadian Economy And Canadian s Quality Of Life1447 Words   |  6 Pagesbeverages and consumer products. These firms make significant contributions to the Canadian economy and Canadian’s quality of life. The manufacturing industry has been helping the Canadian economy grow and become stronger but for 2015, this has not been the case. This report will be focusing on the manufacturing industry and how it coincides with Canada’s economy. The three subtopics focused on in this report are the effects of the manufacturing industry on gross domestic product (GDP), inflation and unemploymentRead MoreGhanas Agriculture Sector Essay1579 Words   |  7 PagesThe agriculture sector is an important asset for Ghana’s economy. It accounts for one-third of gross domestic product (GDP), and provides over 55% of the population’s jobs (Ghana Agriculture). Ghana’s climate is tropical; warm and dry along the southeast coast; hot and humid in th e southwest, and hot and dry in the north. The terrain is mostly low plains with divided plateau in the south-central area. The overall percentage of land use is 17.54% of arable land and 9.22% of permanent crops. EnvironmentalRead MoreEconomy of Singapore1620 Words   |  7 PagesEconomy of Singapore Singapore enjoys a highly developed and successful free-market economy, a remarkably open and corruption-free business environment, stable prices and one of the highest per capita gross domestic products in the world. Exports, particularly in electronics and chemicals, and services provide the main source of revenue for the economy. Singapore is positioning itself as the region’s financial and high-tech center. Singapore’s economic strategy proved a success, producing realRead MoreTesco in China1479 Words   |  6 PagesUK, which means this has had an impact on the inflation rate which has increased , the unemployment rate which will also decrease, the interest rates have changed, and there is growth in the economy. Inflation is the general rise in price of the products for the economy. The inflation rate in the UK is 2.7%, thinking about the economic climate the UK was in. if you look at the bigger picture the inflation rate has decreased in numbers compared to when it went up to 8%. It is measured by the consumerRead MoreHave You Ever Thought About That Economic Is Effect In844 Words   |  4 Pagesthat Economic is effect in our daily life? For example, every day, we will have to decide how much we can spend for our foods, clothing, and paying the bills. Like in our textbook said that â€Å"We could not get everything we want therefore we are naming the Scarcity.† In this essay, we will discuss about the U.S. Economy for the years between 2006 and now in terms of macroeconomic measures discussed in the course GDP, unemployment, and inflation rates. First, GDP is the dollar value of all goods andRead MoreGdp Is the Best Measure of a Countrys Standard of980 Words   |  4 PagesGDP is the best measure of a country’s â€Å"standard of living† Discuss Gross Domestic Product (GDP) is the value of everything produced in the economy for the year. It usually is used to provide economic growth rates and other important data, it is valued in terms of the cost of all inputs. Gross means total; domestic means it applies to everything produced within the economy, product means output. Standard of living refers to the wellbeing of the population, this requires a very wide range of dataRead MoreEconomic Growth Between India And India3046 Words   |  13 Pages Table of content Introduction......................................................................................................................1 What is Economic growth? ................................................................................................2 What is GDP? ..................................................................................................................3 Compare economic growth Australia and India.......................................................Read MoreA Educational Excellence And Standards For More Than 30 Years Essay1545 Words   |  7 Pagesand the world. These economic factors such as human development index (IDH), interest rates, currency exchange, gross domestic product (GDP) and gross national product (GNP) has to be considered when analyzing a country economy for the implementation of a new business. The Thai economy is an economy that relies heavily on export, which accounts for 60 percent of its gross domestic product. Automotive and electronics have a source which has favored the strengthening of the Thai currency, baht. MoreoverRead MoreThe Current Status Of The U.s. Economy1440 Words   |  6 Pagesfrom presidential elections to baseball games can be summarized using statistics (2013). One of the most prevalent uses of statistical analysis is to summarize data in order to reflect the health of the U.S. economy, specifically through gross domestic product (GDP). Wheelan touches on the subject of how statistics can be used in conjunction with economics; however, there is much more he does not mention. The health of the U.S. economy is imperative to every American. It dictates whether it is a good

Metrobank Free Essays

string(33) " ChecksCredit Cards Metrobank E\." The purpose of this study is to research and understand the real-world application system of an existing business information system of a company which is a requirement in the course, Management Information System or BA – 104. B. Group Members and Individual Responsibilities Members:| Responsibilities| Ma. We will write a custom essay sample on Metrobank or any similar topic only for you Order Now Kamille Celebre| She is in charge with the typing of the documents and the information gathered through the interview. She is also in charge for researching about the company via internet. Marie Guianne Janson| She is responsible for editing the paper and the power point as well as the compilation of the work of her group mates. She is in charge of printing the paper and the power point presentation. | Maan Malait| She is in charge with the reserving the projector for the group presentation. She is also the one who gave many information about the company because of the questions she asked during the interview from the resource person. | Charisse Marie Paywan| She is the leader of the group.She has the contact with our resource person in Metrobank. She also gave the group information about the company. | II. Company Information A. History of the company: The Metropolitan Bank and Trust Company (PSE: MBT), commonly known as Metrobank. It has a diverse offering of financial services, from regular banking to insurance. Metrobank is the second largest bank in the country. Metropolitan Bank and Trust Company (Metrobank) was established by a group of businessmen on September 5, 1962 at the Wellington Building in Binondo, Manila.In August 1963, the bank’s first branch was established in Divisoria. Four years later, Metrobank opened its Davao branch, the bank’s first provincial branch. At the onset of the 70s, Metrobank opened its first international branch in Taipei. The Central Bank, on April 1977, authorized Metrobank to operate a Foreign Currency Deposit Unit (FCDU). In the same year, branches and offices totalled 100 and the bank inaugurated its new Head Office at Metrobank Plaza in Makati. On August 21, 1981, the Central Bank authorized Metrobank to operate as a universal bank. Following the grant of the universal banking license, Metrobank entered the following ventures: the acquisition of majority ownership of Philippine Savings Bank (the second largest savings bank in the country at that time); the establishment of a joint travel agency venture with Thomas Cook Group in Thomas Cook Phils. , Inc. in 1986; and the tying-up with Toyota Motor Corporation of Japan and Mitsui to put up Toyota Motor Philippines in 1988.Metrobank subsequently entered into joint ventures with several renowned corporations like Sumitomo Mitsui Banking Corporation of Japan to create Sumigin Metro Investment Corporation; the National Mutual Holdings Ltd. of Australia to create Philippine AXA Life Insurance Corporation; and the ORIX of Japan to create ORIX Metro Leasing and Finance Corporation. In September 1982, the number of Metrobank branches, offices and subsidiaries surpassed the 200 mark. A year later, Metrobank topped all the private domestic bank in total resources with P8. 8 billion. The bank continued to experience steady growth through the years and in September 1989, it increased its authorized capital stock from P2 billion to P5 billion. The bank’s total capital funds on June 30, 2006 stood at P57. 3 billion. Its consolidated resources amounted to P588. 1 billion as of the same period. As of June 2007 assets reached P669. 1 billion ($14. 5 billion) (P46=$1).Metrobank’s subsidiaries are Toyota Motor Philippines Corporation, Philippine Savings Bank, First Metro Investment Corporation, Metrobank Card Corporation, ORIX Metro Leasing and Finance Corporation, SMBC Metro Investment Corporation, First Metro Travelex (formerly Thomas Cook (Phils. )), Philippine AXA Life Insurance Corporation, Mirant Global Corporation, Philippine Charter Insurance Corporation, MBTC Technology, Inc. , Toyota Financial Services Corporation, Toyota Cubao, Inc. , Toyota Manila Bay Corporation, First Metro Securities Corporation, First Metro International Investment Co. Ltd. , Metropolitan Bank (Bahamas) Ltd. , MB Remittance Center Inc. (USA), Metro Remittance Singapore, Metro Remittance UK Limited, Metro Remittance (Italia) SpA, Metro Remittance S. A. (Spain) and MBTC Exchange Services GmbH (Austria). The Metrobank Group has a combined network of over 800 local and international branches/offices, remittance offices and subsidiaries worldwide. It has 557 domestic branches and 32 offices in New York, Hong Kong, Tokyo, Osaka, Seoul, Pusan, Guam, Taipei, Kaohsiung, Madrid, Barcelona, Vienna, Rome, Bologna, Milan, Singapore, Chicago, Hawaii, and Shanghai.On September 28, 2009, Metrobank is the first local bank to offer a line of CNY denominated offerings. B. Company Profile: Mission amp; Vision of the company Vision Statement We envision: A professionally run, responsive, proactive, and creative organization through which the Metrobank Group of Companies is able to express its commitment to lead the private sector in fostering holistic human development in both the national and international arena, thereby effecting an empowered society whose members are able to realize their human potential. Mission StatementTo realize its vision, the Foundation shall: Propagate a culture of excellence with a human face by actively implementing, assisting, and supporting programs which strengthen and advance the strategic sectors of society as well as respond to the needs of the disadvantaged. General Strategies and Approaches In order to achieve its stated mission, the Foundation shall actively engage in: †¢Strengthening and upgrading the professional skills of Foundation personnel to enable them to implement programs in keeping with or even surpassing the standards set by experts in the field of social development. Involving the officers and staff of the Metrobank group in the social development program of the foundation. Organizational Chart Manager Frederick Javate Branch Operating Officer Joanna Marcela Branch Operating Officer Stephen Delmoro n New Accounts Katrina Luna New Accounts Christine Paywan Teller3 Johannah Diaz Teller2 Marisol Jardineros Teller1 Dana Barios C. Products/Services * HOUSING AND CAR LOANS * CREDIT CARDS| * INTERNET BANKING| Bills Payment SolutionCar Loan SolutionHome Loan Solution| * MOBILE BANKING| PERSONAL ACCOUNTSTime Deposit (TD)MetroDollar Time DepositForeign Currency Time Deposit * CHECKING ACCOUNTS Account OneRegular Checking AccountMetroChecking Extra * SAVINGS ACCOUNTSPassbook Savings AccountMetrobank E. T. Savings AccountMetroDollar Savings AccountOther Foreign Currency Savings Account (FXCY SA)Fun Savers Club * PERSONAL INSURANCE| * Traditional Life Insurance Products * Investment-Linked Products (ILPs) or Unit-Linked Products (ULPs) | * PHONE BANKING * TRAVELING| Travelers ChecksCredit Cards Metrobank E. You read "Metrobank" in category "Papers" T. | * BUSINESS * CORPORATE ACCOUNTSSavings Accounts.Checking AccountsTime Deposit * CASH MANAGEMENT| | Metrocash ManagerMetrobank direct Corporate * CORPORATE LOANS Loans for Capital ExpendituresCorporate Finance and ConsultancySME amp; Other Government Supported LoansTRADE PRODUCTS amp; SERVICES DIRECTORY OF TRADE PROCESSING HUBS * Financing for Imports and Domestic Purchases * Financing for Exports| | CORPORATE ISSURANCE| * Group Yearly Renewable Term Plan Security Assurance for Employees (SAFE) Plan * Group Credit Life Insurance * Group Personal Accident Plan * Group Student Personal Accident Plan * Group Retirement Plan CORPORATE LEASINGGOVERNMENT LEASING| | * BIR eFPS Tax Payments * SSS Contributions and Payments| | INVESTMENTS TRUST PRODUCTS AND SERVICES * Personal Trust and Investment Services * Corporate Trust and Investment Services TREASURY PRODUCTS| GOVERNMENT SECURITIES * Peso Treasury Bills (T-Bills) * Peso Fixed-Rate Treasury Notes (FXTNs)| | * Peso Retail Treasury Bonds (RTBs) * For eign Currency-Denominated Bonds (ROPs)| * US Treasury Bills (US T-Bills)| CORPORATE SECURITIES 1. Peso or USD Denominated Bonds 2.Corporate Promissory Notes * FOREIGN EXCHANGE * INVESTMENT FUNDS NAVPU amp; PERFORMANCE * CAPITAL MARKETS| * MARKET COMMENTARIES| III. Business Information System A. Description amp; Overview of the System * MOSAIC This is the system used by Metrobank in processing a transaction. This has a command were to deposit, withdraw, debit/credit, encash check and inquire. * Black Screen (IB3220) This is where we could inquire an account like MOSAIC but in this system we could see the history of an account. * Branch Automation System (BAS) This is an input of information of clients. Microsoft Word and Excel These are system used by the company to store data. B. Information Flow Open Day PICOS Debit/Credit payment, deposit, withdrawal, encash and inquire Middle Day Balancing Transfer of Cash to offer payment, deposit, withdrawal, encash, inquire amp; debit/ credit Transfer of co- teller Transfer of cash ( bundles amp; PICOS) End of Day C. Input of Data Resources Data are captured by means of interview to the clients. They input the information to the Branch Automation System. This is used by new accounts to input information.After the information is filled up to their system our efficient will approve it, then an account is open and now can transact to their teller and also to ATM. Data adjustment can be done upon presentation of document like in change of status. She must present a marriage contract amp; updated ID before they can change a file. Inquires in their company, they have a policy it is called Secrecy Law (RA1405). They are only the account holder can be the one who can only inquire he’s/she’s account to their bank. D. Processing of Data * Clearing checksThe teller received a checks, he/she must check first the face of the check like name of the payee, date, amount in words amp; figures, and the signature of the issuer. The bank officer will validate if the check being used is authentic. After validation and the check is found authentic, the check will be stamped at the back with bank endorsement. The check is now ready for processing. The processing can only be cancelled if the client submitted an authorization letter for cancellation to good the check or any check transactions that are still on process. The officer will counter sign that specified check on the bank endorsement.The next step it will be encoded to the branch then it will be sent to PCHC (Philippine Clearing House Center). If there is a bank to bank transaction, PCHC will debit the issuing bank then credit to issuer. * Payroll The teller will post the payroll submitted by the different branches of Metrobank through their terminal which is reviewed and approved by the officers because at the end of the day all employees of the companies can withdraw their payroll through ATM. The term Terminal is their company jargon for the software they are using to store and survey data.Before a client can install money for payroll, the client must issue an authorization for installation of money and releasing of payroll money. This payroll system is used by large scale companies. * Deposit The teller received cash and checks deposits they validate it through their terminal at the end of the day they balanced all their transactions. The cash were turned- over to the cashier while the checks are forwarded to the clerk and it is retuned to the head office. Before a teller can start his transaction for this day, he must seek open day permission from the bank officer.Open day is their term for acquiring access for starting bank transactions. Before executing transfer transaction a teller must have his PICOS or his initial cash. A teller has limit of 500,000php on hand; if he/she exceed the limit, the teller must surrender the excess to the clearing clerk. The clearing clerks are the people who monitor the inventory of money. In addition, this person is responsible for encoding of data transfer to the system and the system will send the data to the main office. E. Output of Information * Reports The reports are being executed after office hours.These are essential for monitoring bank operations. The report to be gathered will be subjected to analysis (data analysis, cash flow analysis, transaction analysis) they do report analysis to know the rank amp; performance of their company. The reports will serve as surveillance to know if the competitor is liquid or having liquidity problems. These data will their basis to compete with other companies. These reports are encoded into the computer to be used for call backing. Call backing is their term for rechecking data inputs to determine if there is error being committed and securing bank transaction placement Documents * Checks * Official receipt * Deposit slips * Withdrawal slips * Payment slips * Debit/credit memo * Application for miscellaneous transactions * Displays/responses They use terminal to encode, transmit amp; validate transaction. This display falls under the supervision of MOSAIC and BLACKSCREEN Systems. These systems are used to store and retrieve personal data and accounts of the clients. * Control listing The clients must submit instruction letters to authorize the bank to perform the processing of his/her transaction.A client must submit a payroll listing whenever they request to have a fund for their employees. * Input of other System An example of input of other system is when customers’ will be open an account for saving and payroll purposes for the company. This means that the company and the bank have an agreement regarding this transaction. If a company opens an account it can easily process the payroll of each employee because they have an account in the bank. F. Storage of Data Resources The data resources are organized through the storage of their files to their system and filing cabinets. It is sorted alphabetically and numerically so that whenever they need to search something, it could easily be found. G. Control of System Performance: The input, process, output and storage activities are monitored by checking their officers the media, files amp; processing of their work. IV. Conclusion We conclude that those business information systems that we had taken from that company are very important and useful because those systems help them to make their work easier and fast. Those kinds of system are accurate for their company. These systems helped them looking for the information that they needed. In this company they use business information system for them to know what’s wrong with their work so with the help of the systems, they can easily correct it through the use of the information system. There should be a process to be followed by this company because with this process it can easily understand and determined the work of each employee. V. Acknowledgement The group would like to thank Metropolitan Bank and Trust Company (Metrobank) in Rosario branch in Pasig for allowing us to know the information system they used for their business processes.We also thank them for the knowledge and information they gave to us to be able to understand more the processes of banks, especially metrobank. It’s a pleasure and honour to conduct an interview in one of the top commercial banks here in our country. We also like to express our gratitude towards them because of their warm and friendly employees who supported us during the interview. We also want to acknowledge the sister of Charisse Paywan, Ms. Christine Paywan for being our resource person for this project.We would like to thank our family for being supportive and for allowing us to conduct an interview at Metrobank. We also thank our friends for being supportive, for helping and for being an inspiration to us. Lastly, we would like to thank Mrs. Josefina Bina for letting us experience this kind of project that will surely help us in our endeavour when we start working in the corporate world. Hopefully, we can apply all the knowledge and information we have gathered during the one semester in Management Information System. Thank you very much and God bless us all How to cite Metrobank, Papers

Heterogeneity and Relationship Management †MyAssignmenthelp.com

Question: Discuss about the Heterogeneity and Relationship Management. Answer: Introduction The case study Mixed Fortunes at Dominos is based on a compilation of investigative reports by Fairfax media. The case highlights some problems experienced at Dominos. Some of these problems include the stress on the franchisees who think the investment is not working well for them as the costs of running the outlets increase while the prices of pizza decline due to competition. There is also a problem with employees unhappiness due to underpayment and working for long hours without compensation. Some franchises consider the head office style as dictatorial putting pressure on the employees and the franchisees. This paper will discuss the background to the Dominos case, suggested solutions and recommendations. Dominos is an Australian pizza chain comprising a network of franchises and over 600 retail stores nationally. The company was listed on the Australian stock exchange in 2005. The company has been very successful with the shares having surged 2500 per cent in over a decade making it one of the best performing in the market. The company has the largest pizza menu with over 200,000 options. Dominos offers service guarantee to the customers of deliver between 15 to 20 minutes for extra cost. The business model is using franchisees to grow sales with the head office earning royalty from every sale as opposed to profits. The company encourages more stores being opened to increase the sales and thus royalties for the head office. The situation however has not been very rosy for the franchisees as a number of problems have been reported. These issues need to be addressed if the company is to continue with the success story. The effective management of restaurants lifecycle and the quality o f life issues are important for growth and development of a restaurant (Parsa, Self, Njite King, 2005 p 304). Identification of Issues and Problems The first issue is on royalties taken by head office based on sales that encourage more stores in one region to increase sales. The franchisees are required to pay the royalties based on sales and not profits. This means whether an outlet is making profits or not, it has to pay royalties to the franchisee making the business untenable for franchisees and leading to their inability to pay the operational costs and make a profit or recoup their investment. The Franchisees feel as if the head office is interested only in their welfare and not their welfare. The push for higher sales puts unnecessary pressure on the employees and thus burn out. The issue of quarterly bonuses to the store managers is a good motivator to increase sales. However it might do the opposite of low morale to other employees if they feel left out in the recognition. The CEO should not get engaged in the minute details of micromanaging employees but focus on the strategic part of the business. When a franchisee is not doing well, the stores management is blamed for poor performance. There is no evidence of any support to the franchisee from head office in order to improve on performance. While the franchisee costs are increasing, their profits are declining because the cost of pizza is declining due to reduced pizza prices as a result of competition. Dominos profit is doubling while the franchisees struggle to make profits as they cannot pass on their costs of operating. The CEO is well educated, talented and experienced. He is focused on growing the people and the business. He knows how to deal with challenges and turning them in to opportunities. He takes risks in changing the business model with the current revolution on retailing and social media use. Staff retention is high and thus improvements in efficiency and reduced mistakes. This is viewed as good for the company. The labor costs have also gone up especially due to legislation and employees are more engaged. The employees are encouraged, incentivized and trained to keep them more engaged and motivated. The top employees are taken on a tour to the Silicon Valley, USA every year to learn about technologies that could be introduced to the company. However, many employees are not happy as they work overtime without payment and suffer from burn out. They are afraid of reporting to head office. The employee who reported never received feedback from head office. The company is therefore not living the CEOs motto of zero tolerance to worker exploitation. There are illegal and improper work practices that are making the employees unhappy. The employees are underpaid by lowering the hours worked thus reducing their pay. Some reported working for very long hours and the working environment not good lacking in basic facilities like air conditioning. When this was reported, the company terminated the contract of some franchisees. The company does not tolerate exploitation of workers. However, some of the workers dues remain unpaid. Due to the pressure on the franchisees, some unauthorized practices have arisen. This is affecting the standards of pizza negatively. They were making more pizza per bag of flour than allowed in order to increase their earnings. They say they are not making any money and require the head office to support them meet their increased costs. These improper practices will likely affect the companys reputation, sales and the future success. Possible Solutions For the business to be successful, head office must work together with the franchisees and cooperate in resolving the problems that are being faced. Proper communication, control and s strategy that is influencing are seen as key factors in influencing the competitive advantage of franchises (Inma, 2012 p4). When the franchisees feel as if the company does not care about their welfare, they will not deliver on their goals and this will lead to a bad reputation on the company and loss of customers. Proper channels and strategies for conflict resolution between franchisor and franchisee will be of great help (Strutton, Pelton, Lumpkin, 1993). An overhaul of the franchisees remuneration may be needed to ensure that they are motivated in business. Royalties based on sales are not working for them as they are not making profits. Another method that takes in to account sales and the profitability of the outlets can be considered with consultation between all parties. Head office support in outlets with higher operational costs may be necessary to keep them in business. Employee motivation and engagement needs to be reviewed. Unhappy employees do not deliver the results as per expectation. If this is not addressed, it will soon lead to customers mistreatment and dissatisfaction too. The employees need to be consulted and involved in decision making so that they believe the decisions made cater for their welfare. Only when they feel important will they contribute fully to business success. The labor practices need to be fair to avoid law suits. The salaries that have been unpaid need to be paid and the working environment needs to be conducive. Proper expertise of the business is needed by people who understand the franchise business. Proper leadership and guidance will benefit both the franchisor and franchisee and in the long run lead to business success. There are stakeholders who are important for success of the business and need to be taken care of (Mottl, 2016 para 7). These include the employees, the customers, the community in which you operate and the franchisees. All their interests must be looked in to gain their loyalty as they determine how successful the business will be. The business strategy must support the brand and make it stand out. It also must support differentiation and growth and profitability of the franchisee and the overall business. The franchisor needs to consult with franchisee before revision of strategy (Mottl, 2016 para 5). Recommendations The franchisor needs to employ strategies that will enhance employee and customer retention. Customer satisfaction has a strong effect on loyalty of customers (Gustafsson, Johnson and Roos, 2005 p 210). Loyal customers in turn tell others about the business and act as the ambassadors by spreading a positive word about the business (Nyadzayo, Matanda, and Ewing, 2011). This will be achieved through regular training and engagement activities for the employees at the same time close monitoring to ensure best customer service for the customers. Necessary tools to survey customer service parameters like NPS, waiting time, customer satisfaction will be necessary and necessary measure put to keep on improving. Another strategy is consolidation of the market where the franchisor analyses the market regularly with a view of understanding the market and structuring the business model to suit the market conditions. The franchisee in turn must understand the business model as defined by the franchisor in order to align appropriately for success. Franchising represents strategic alliance between franchisor and franchisee (Hoffman, 1991 p75). Relationships management is therefore very critical when building a strong franchise business (Inma, 2002 p3). This paper has discussed the issues and problems in Dominos case study and given some suggested solutions and recommendations. References Gustafsson, A., Johnson, M.D. and Roos, I., 2005. The effects of customer satisfaction, relationship commitment dimensions, and triggers on customer retention.Journal of marketing,69(4), pp.210-218. Hoffman, R.C. and Preble, J.F., 1991. Franchising: Selecting a strategy for rapid growth.Long Range Planning,24(4), pp.74-85. Inma, C., 2002.Building Successful Franchises: the Influence of Franchise Heterogeneity and Relationship Management on Franchise Success(Doctoral dissertation, Murdoch University). Mottl, J. (2016). 5 Strategies for Franchise Success over the Long Haul. Retrieved August 22, 2017 from: https://www.fastcasual.com/articles/5-strategies-for-franchise-success-over-the-long-haul/ Nyadzayo, M.W., Matanda, M.J. and Ewing, M.T., 2011. Brand relationships and brand equity in franchising.Industrial Marketing Management,40(7), pp.1103-1115. Parsa, H.G., Self, J.T., Njite, D. King, T., 2005. Why Restaurants Fail.Cornell Hotel and Restaurant Administration Quarterly,46(3), pp.304-322. Strutton, D., Pelton, L.E. and Lumpkin, J.R., 1993. The influence of psychological climate on conflict resolution strategies in franchise relationships.Journal of the Academy of Marketing Science,21(3), pp.207-215 .

The Role of Advance Practice Nursing Essay Example

The Role of Advance Practice Nursing Paper Throughout history nursing has been defined in many ways. In recent years the field of advance practice nursing has emerged as nurses are taking on more challenging and comprehensive roles within the health care field. One may define an advance practice nurse in many ways. According to the Department of Regulation and Licensing in Wisconsin, and advanced practice nurse is a registered nurse with the following credentials: (1) holds a professional nursing license within the state, (2) is certified by a national certifying authority as a nurse practitioners, registered nurse anesthetist, clinical nurse specialist or other nursing specialist and (3) a registered nurse who holds a graduate degree by an accredited university (DRL, 2004). This definition is fairly standard among most other nursing institutions. In most cases advanced practice nurses may not prescribe medications, though there is now a certification APNs can get that allow them to prescribe medications in certain instances. According to the American Nurses Association and advanced practice nurse or APN is an umbrella term given to a registered nurse (RN) who has met advanced educational and clinical practice requirements (ANA, 2005). We will write a custom essay sample on The Role of Advance Practice Nursing specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on The Role of Advance Practice Nursing specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on The Role of Advance Practice Nursing specifically for you FOR ONLY $16.38 $13.9/page Hire Writer An APN therefore generally has more than 2-4 years of basic nursing education (ANA, 2005). An APN is expected to carry out more autonomous responsibilities than a traditional RN, including diagnosis and treatment of patients in many instances. One may conclude from these two comparisons then that an APN is a highly specialized nurse with advanced skills in diagnosis and treatment of disease among other things. Role of APN APNs come in many forms and their roles change significantly depending on their specialty or key area of practice. The more common specialties or fields a nurse takes on include nurse practitioners (NP), Certified Nurse Midwifes (CNM), Clinical Nurse Specialists (CNS) and Certified Registered Nurse Anesthetists (CRNA) (ANA, 2005). The role of an APN varies according to their specialty, however most provide a multitude of services for patients in employment settings, clinical care settings, retirement communities, hospitals and even schools (ANA, 2005). Because most people are familiar with the term nurse practitioner or NP, well examine the role of a NP more closely. Recommended Reading   Nursing Practice A NP usually works within a clinical setting, private office, and hospital or in a nursing home (ANA, 2005). Many are specialized in a specific field like pediatrics or obstetrics. NPs conduct a variety of medical care tasks, which may include diagnosis, comprehensive medical histories, physical examinations, interpretation of labs or X-rays and patient education (ANA, 2005). Nurse Midwives on the other hand provide gynecologic and obstetric care for women including prenatal care and labor and delivery care (ANA, 2005). Certified nurse midwifes represent one of the fastest growing areas of APN practice in recent years (ANA, 2005). The role of the APN also includes psychological support for patients and their family members. Nurses generally engage in much more intimate relationships with patients in many situations than primary care providers or physicians. They often have the opportunity to talk more to patients about their histories, current environment, lifestyle and needs, wants and desires with regard to health care practices (Lumby, 2004). This intimate bond opens many avenues for support and growth within the healthcare profession as nurses begin realizing new ways of meeting patient needs and offering the highest possible level of quality care. Lumby (2004) suggests that the term advance practice nurse or even nurse practitioner is one that is controversial at bet because the term practitioner specifically has usually been reserved for doctors. The author also points out that all nurses are practitioners of nursing regardless of their skills or expertise (Lumby, 40). The author challenges the profession of nursing to focus on key issues, which she defines as developing the capacity to research and articulate the evolution going on within the profession (Lumby, 41). Among the current issues facing advance practice nurses and the nursing profession in general include finding methods to delivery consumer focused quality health services and shift individuals way of thinking from a provider driven system to a consumer driven system that enables consumers to make informed choices regarding their healthcare (Lumby, 41). Issues and Discussion of Advance Practice Nursing Lumby makes a good point. It is not nearly as important to define an advance practice nurse as it is to define what techniques, methods and practices nurses will need to adopt in the future to drive health care in a consumer oriented direction. The health care industry has long faced many crises none the least of which is providing adequate health care to an increasingly diverse population. Advanced practice nurses, with additional training and more specialized care, are interacting even more than RNs with patients on a daily basis. They are playing key roles in the health outcomes of patients in the short and long term in many instances. Many APN are also making decisions that ultimately will affect a patients long-term health and well-being. It is important as Lumby points out that APNs focus their attention on enabling or empowering consumers to make independent choices regarding their health care. Consumers want to feel they are taking an active role in the decision making process when it comes to their health and well being. APNs can help facilitate this process by informing patients and apprising them of their choices in a health care setting. Much like a physician most APN conduct autonomous decisions when diagnosing and treating complex symptoms in patients. APNs must not only be clinically skilled at diagnosing and assessing but also integrate important skills such as education, communication and leadership and brings these factors into the patient nurse relationship. The role of the APN will likely continue to change with time as the health care standards within the nation and across the globe continue to change. New roles and specialties within the field of advance practice nursing will also emerge as healthcare evolves and changes in the upcoming years. Hopefully these changes will ultimately result in better health care services and better defined roles for both caregivers and patients in a healthcare setting. In addition APNs will likely continue to face ongoing challenges in the healthcare arena, including challenges presented by working under a managed care system that doesnt afford equal access to health care to all people in the states. APNs should continue to collaborate closely not only with colleagues and physicians but also with members of the community and patients to broaden their experience and develop new methods for meeting consumers needs in as Lumby calls it, an increasingly consumer driven practice. Bibliography : ANA. Advanced practice nursing: A new age in health care. 1997 American Nurses Association. 23 Sept 2005: http://www. nursingworld. org/readroom/fsadvprc. htm DRL. (2004 Jan). DRL Advanced Practice Nurse Prescriber. January 8, 2004. Wisconsin Department of Regulation and Licensing. 24, Sept 2005: http://drl. wi. gov/prof/nura/def. htm Lumby, J. (2000). Clinical challenges: Focus on nursing. St. Lenoards, Allen ; Unwin.

Rural Poverty in Indonesia

Rural Poverty in Indonesia Introduction In spite of the recent occurrence of global economic recession, the economy of Indonesia has been going on growing at a steady rate, making the country to be classified among the middle-class countries.Advertising We will write a custom research paper sample on Rural Poverty in Indonesia specifically for you for only $16.05 $11/page Learn More Due to Indonesia realizing constant economic growth, there has been a steady decrease in the overall poverty level in the country: the level has dropped from 17%, witnessed in the year 2004, to about 12.5% in the year 2011 (IFAD 1). However, even if Indonesia has realized a reduction in the overall poverty level, the poor people, especially those living in the rural areas in this country, are currently worse off and the gap between the wealthy people and the poor is getting wider and wider (IFAD 1). In this paper, I am going to support my viewpoint that; despite Indonesia realizing substantial economic gro wth, rural poverty in the country remains to be a big problem that needs to be addressed with urgent need. The conclusion section of the paper will present a summary of discussion. Rural Poverty in Indonesia Suryahadi and Hadiwidjaja point out the idea that Indonesia’s power to bring down the level of poverty became stronger after the occurrence of the Asian financial crisis (Suryahadi and Hadiwidjaja 20). However, they also offer an explanation that there is a slower rate of poverty reduction among the rural poor (Suryahadi and Hadiwidjaja 20). They point out that the growth of Indonesia’s economy does not benefit individuals who need to be greatly attended to (Suryahadi and Hadiwidjaja 20). As on one hand a larger number of people living in poverty are found in the rural areas, on the other hand, there exists â€Å"a division in which the pace of poverty reduction slows down in rural areas and speeds up in urban areas after the crisis† (Suryahadi and Hadiwidja ja 20). Moreover, these researchers observe that, the contribution made by the â€Å"urban services sector growth†, which is found to be very much effectual in poverty reduction, reduced for the rural regions after the occurrence of the Asian financial crisis (Suryahadi and Hadiwidjaja 20).Advertising Looking for research paper on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More Following this, the impact of the â€Å"urban services sector† is not currently felt in the rural areas in the same way it used to be before the occurrence of the Asian financial crisis. As a result, it is not a big surprise that the overall rate of reduction of poverty level in Indonesia decreases (Suryahadi and Hadiwidjaja 20). Approximately fifty percent of the Indonesian population lives only slightly above the poverty line (IFAD 1). This population that is near to poverty is prone to such unfavorable conditions as incre ases in the food prices, poor health, natural calamities among other factors, which can easily take them back to poverty (Hasan, Rana and Quibria 261). In spite of the country taking appropriate measures, in the recent times, to bring improvements in the health as well as education sectors, the quality of health care and public services cannot measure up to the same standards as those of other middle-income nations but remains behind (Loayza and Raddatz 141). It is also reported that high levels of undernourishment among the young kids, higher levels of deaths among mothers, lack of clean drinking water and poor quality of education for children, are found to be the most common problems affecting the poor people living in rural areas in Indonesia (IFAD 1). An example of a fluctuation in food prices causing an increase in the poverty levels among the near-poor people can be given of a situation that occurred during the years 2005 and 2006. During that time, the Indonesian government banned imports and this led to an increase in domestic rice price (Suryahadi, Hadiwidjaja and Sumarto 7). This was considered by a number of researchers as being among the main causes of the increase in the poverty levels (McCulloch 45; Warr 14; World Bank 1). It is pointed out that, even if there was introducing of â€Å"the UCT and an expansion of Raskin benefits around the same time, near poor households were unable to cope with the rising price of their single most important consumption good† (Suryahadi, Hadiwidjaja and Sumarto 7). About 70% of the total number of the people in Indonesia lives in the rural areas and their major source of income is farming (IFAD 1). Research shows that poverty in these rural areas is on the increase and it has been reported that about 16.5% of the people in the rural areas live in poverty as compared to about 9.9% of those who live in urban areas (IFAD 1).Advertising We will write a custom research paper sample on Rural Poverty in Indonesia specifically for you for only $16.05 $11/page Learn More Wetterberg, Sumarto and Pritchett point out that in Indonesia, the difference in the rates of poverty in the urban and rural areas always stands at above 6%, apart from the case of the year 1998, in the course of the Asian financial crisis which adversely affected the people living in the urban centers more than those living in the rural areas (Wetterberg, Sumarto and Pritchett 145). A very large number of small-scale farmers are not able to capitalize on the available opportunities that economic growth offers (IFAD 1). The farmers are mostly not in a position to have access to the financial and agricultural extension services and they also do not have good and reliable markets for their farm products (IFAD 1). Moreover, production of food by the rural population greatly puts focus on satisfying the subsistence needs (de Janvry and Sadoulet 13). Even if this country engages in the production of the crops that have a high market value such coffee, cloves and cocoa among others, the government has not invested much in the processing, marketing and management systems which are required in the expansion of production and â€Å"take full advantage of this demand† (de Janvry and Sadoulet 13). Poverty in Indonesia is more prevalent in the isolated eastern islands than other areas and in this region, about 95% of the people in the rural areas live in poverty (IFAD 1). In most parts of this region, people engage in subsistence farming. The native people that have always been marginalized and have not been able to benefit from the development programs put in place by the government are in these areas. The areas in the coastal region have been environmentally degraded and the villages can only be accessed with much difficulty. People living in these areas find that the only way they can overcome the problem of poverty is to migrate to the urban areas (IFAD 1). Some research findin gs have shown that migration to urban areas from the rural areas plays a big role in poverty reduction.Advertising Looking for research paper on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More For instance, Abuzar Asra, following his research on poverty levels among the people who live in urban areas and rural areas, found out that in the period between 1987 and 1996, there was significant decline in poverty levels as a result of rural to urban migration in Indonesia (Asra 1). Moreover, the women, especially those living in rural areas in Indonesia, are very susceptible to poverty. They have limited access to quality education, receive less pay as compared to men and they are often discriminated against in their communities as well as their households and may be excluded in decision making (Miranti 80). Conclusion The argument in this paper has been that: despite Indonesia realizing substantial economic growth, rural poverty in the country remains to be a big problem that needs to be addressed with urgent need. It has been found out that the country became even stronger in working towards bringing down the level of poverty after the recent Asian financial crisis. However, poverty reduction has been found to be slower in the rural population than in the urban one. Over 70% of Indonesians live in rural areas and basically depend on agriculture for their livelihood. But there is no adequate government support for agricultural production and marketing and the people who live in the rural areas mainly focus on subsistence farming. In addition, women and people living in remote areas have been marginalized and discriminated against and they do not have sufficient access to the government services. Moreover, the people in rural areas in Indonesia are also vulnerable to some unfavorable conditions such as changing food prices and poor health conditions among others. Such conditions may not make it possible for these people to evade poverty completely. It is important that the Indonesian government take necessary measures to ensure all its people receive equal benefits from the economic growth that is being realized by the country. Asra, Abuzar. Urban-rural differences in costs of living and their impact on poverty measures. n.d. Web. de Janvry, Alain and Sadoulet Elisabeth. â€Å"Agricultural Growth and Poverty Reduction: Additional Evidence.† World Bank Research Observer 9.25 (2009): 1-20. Print. Hasan, Rana and Quibria George. â€Å"Industry Matters for Poverty: A Critique of Agricultural Fundamentalism.† Kyklos, 57.2 (2004): 253-64. Print. IFAD. Rural poverty in Indonesia, 2012. Web. Loayza, Norman and Raddatz Claudio. â€Å"The Composition of Growth Matters for Poverty Alleviation.† Journal of Development Economics 93.1 (2010): 137-151. Print. McCulloch, Neil. â€Å"Rice prices and poverty in Indonesia.† Bulletin of Indonesian Economic Studies 44.1(2008): 45-63. Print. Miranti, Riyana. â€Å"Poverty in Indonesia 1984-2002: The Impact of Growth and Changes in Inequality.† Bulletin of Indonesian Economic Studies 46.1 (2010): 79-97. Print. Suryahadi, Asep and Hadiwidjaja Gracia 2011, The role of ag riculture in poverty a Poverty, food prices and economic growth in Southeast Asian perspective. Singapore: Institute of Southeast Asian Studies, 2011. Print. Wetterberg, Anna, Sumarto Sudarno and Pritchett Lant. â€Å"A national snapshot of the social impact of Indonesia’s.† Bulletin of Indonesian Economic Studies 35.3(1999): 145-152. Print. World Bank. Managing through a global downturn: East Asia Update. Washington DC: World Bank East Asia and Pacific Region, 2006. Print.

Air Forces Northern incident awareness and assessment playbook Essay Example for Free

Air Forces Northern incident awareness and assessment playbook Essay Science (824) , Play (788) company About StudyMoose Contact Careers Help Center Donate a Paper Legal Terms & Conditions Privacy Policy Complaints ?   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   The United States Northern Command (USNORTHCOM) is the combatant command that is responsible for security and defense. They conduct Defense of the Civil authorities through providing capabilities to the DOD, Department of Defense from their land, air and sea components in support of the leading federal policies geared towards responding to any homeland security threat.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Among the capabilities that the DOD brings to their operations is the ISR and IAA. There is no difference between these two terms only that the term IAA has just been coined by the USNORTHCOM to denote the application of ISR when it is applied domestically to support the homeland security. The ISR operation mainly consist of flying both manned and unmanned platforms which are set to revolve over the battle field top provide a clear picture of the situation underneath. During the wartime, this picture could include the location of roads and deposition of the enemy and also the information that may be required so as to target the enemy. ISR provides a clear picture of situational awareness that could not only be used strategically to gain the full picture but also tactically to gather intelligence information that are useful in engaging individual targets. The situation awareness that is provided by the IAA/ ISR becomes a significant force multiplier which the commanders have been known to highly rely on.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   There are many obstacles to realizing full potential for the ISR in homeland security. Currently there is statutory, doctrine, ethical and policy obstacles that exist to prevent ISR from reaching their full capacity for the homeland security provision.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Improved doctrines will see the department of Defense improve their ability to deliver IAA capabilities to the local, tribal, state and also the federal entities. The consumers all over the country and also the whole world will benefit from improved IAA capabilities.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   The most significant ethical issues come secondarily where IAA capabilities are employed domestically. This is because it is known that all the American citizens enjoy freedoms of privacy, expression and they expect this to be fundamental and be respected in the best way possible. The American citizens highly value their freedoms and hence loath ideas that seem to threaten their constitutional protection.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   In publicizing the use and purpose of IAA, I think there is a big ethical consideration in it because the citizens will get to know the function of IAA and how they function. They will not think that their freedoms are being infringed on but know that this is a military operation and that is how they are and should be carried hence in so doing, there will be no blame game between the government and the citizens. USAF. (2007). Air Force doctrine document 2-9; Intelligence, surveillance, and reconnaissance operations. Washington, D.C.: United States Air Force. Air Forces Northern. (2010). Air Forces Northern incident awareness and assessment playbook. Tyndall AFB, FL: USAF. USNORTHCOM Public Affairs. (2008, September 18). Hurricane response.

What is Wrong With the Dream Act Essay Example | Topics and Well Written Essays - 250 words

What is Wrong With the Dream Act - Essay Example On the positive side, the Act perhaps advances national security because it provides a wider field for eligibility of military service. In addition, illegal immigrants have an opportunity to become lawful permanent residents, and in time citizens. It is an exaggeration of the benefits of the policy because it disregards trifling issues that may arise later in its enactment. Depressingly, it affects immigration policies and the entire immigration system, besides being a costly process (Sands 642). It is virtually impossible to swear an oath for the United States when one is still theoretically a citizen of another country, in case the unlawful immigrants serve in the military. The DREAM Act affects the immigration system because lawful immigrant would face discrimination in enjoying invaluable benefits of being a citizen. It is bigoted because lawful immigrants take three years to gain citizenship wile unlawful immigrant only need two years to acquire citizenship. This promotes unlawful immigration and destabilizes the immigration system. The Act benefits only a small population, which will enjoy education and work opportunities, while undermining the efforts of a vast majority of lawful immigrants and American citizens who are

Asian Tourism Abstract Essay Example | Topics and Well Written Essays - 750 words

Asian Tourism Abstract - Essay Example n of exterior promotional and publicity activities; systematize and inculcate training and education; and endorse international tourism communication and corporation. In addition, CNTA is responsible for normalization of the tourism market order, and offer supervision and management of quality; and organize the survey, planning, growth and fortification tourist resources. The organization is part of China’s government and is a Chinese government authority obliged to tourism development, and a subordinate to the state council headquartered in Beijing. Although it is an institution affiliated to CNTA the government, CNTA does not have any authority to act as a full Chinese government department hence it has no authority for regulation enforcement although it acts as an independent ministry on some instances. The institution is funded by the central Chinese government and but uses promotional and marketing activities to get additional funds beyond what is provided by the government. Promotional budget for tourism by the Chinese government is limited and for years, this amount remains low compared to nations like Korea, Singapore, and Malysia. It is for limited budgeting that the Chinese government CNTA to depend on other income sources like local government that comprise of social investment and Tourism Development Fund. The financing of the Tourism development Fund is by the collection of an inbound airport construction fee of CNY 20 for each person. In order to monitor the spending of CNTA funds, the Ministry of Finance has founded a budget enforcement live monitoring system and a budget spending performance evaluation. In addition, CNTA and the finance ministry are exploring to develop Tourism Satellite Account and evaluate government revenue estimates obtained from tourism to evaluat e the largely contribution of tourism to Chinese social development and government national economy (Organization for Economic Co-operation and Development 292). According to Airey

Hey I Would Like to Smoke Weed Essay Example for Free

Hey I Would Like to Smoke Weed Essay Opinion essays are discursive essays in which we present our personal opinion on a particular topic. They are normally written in a formal style. An opinion essay consists of: * an introduction in which we introduce the topic and state our opinion clearly. * a main body which consists of two or more paragraphs, each presenting a separate viewpoint supported by reasons/examples. We can include a paragraph giving the opposing viewpoint supported by reasons/examples. * a conclusion in which we restate our opinion using different words. We start each main-body paragraph with an appropriate topic sentence that states the main idea of the paragraph. Each topic sentence is followed by supporting sentences that further explain the main idea of the paragraph. We use present tenses in this type of essay. We also use appropriate linking words and phrases to join your ideas. To list viewpoints: To start with, Firstly, In the first place, In addition, Besides, Furthermore, Moreover, Also, etc. To introduce supporting sentences (examples): for example, for instance, in particular, such as/like, etc. To introduce opposing ideas: On the other hand, However, etc. To conclude: All in all, Lastly, Taking everything into account, To sum up, All things considered, etc. Formal style is characterized by: * formal expressions, advanced vocabulary, longer sentences, e.g.: First-time buyers need to consider their financial circumstances carefully before committing to a mortgage. * Formal linking words/phrases, e.g.: Moreover, steps should be taken to †¦ * No use of short forms, e.g.: There is always something†¦ (NOT: There’s always something†¦) * Impersonal tone i.e. use of the passive, e.g.: Tenants are required to contribute towards the upkeep of the garden.

Alaska Drillings :: essays papers

Alaska Drillings Drilling for oil in Alaska’s Arctic Wildlife refuge will not solve our nation’s energy crisis, but it will destroy one of the worlds most unique animal habitats. The Arctic National Wildlife Refuge would satisfy only six months' worth of the nation's oil needs while oil drilling would "destroy" a wilderness that is home to the 150,000 animals of the Porcupine animal group. Our nations natural refuges should not be turned to destruction when a solution to a problem can be found else where. In addition to not being economically productive, drilling for oil will do nothing to help energy shortages experienced throughout the United States, while still destroying one of the only habitats of its kind in the world. Despite common thought, the Alaskan refuge is not a snow covered desert. It is important to what exactly would be destroyed if the United States decides to drill for oil. The Arctic Refuge is among the most complete and undisturbed ecosystems on earth. The Arctic Refuge contains an impressive variety of arctic wildlife. The rich variety of wildlife found within the Refuge includes more than 160 bird species, 36 kinds of land mammals, 9 marine mammal species, and 36 types of fish. The reality is that opening the Arctic refuge to drilling will accomplish little except destroying one of the last pure preserves of its kind in the world. Another reason why it would be unwise to drill is because it is just not cost efficient. For the oil industry to invest, the Refuge must hold a lot of oil, and the oil must sell for a high enough price for long enough to recover costs and earn profits. We need to think of a solution that will affect us today and will alleviate our problems. In exchange for this short-term return, we would have to pay a very high long-term price, threatening one of the planet's most unique animal and plant habitats. Scientific analyses by the US Fish & Wildlife Service have concluded that drilling would severely harm the refuge's abundant populations of caribou, polar bears, musk oxen, and snow geese. Alaska Drillings :: essays papers Alaska Drillings Drilling for oil in Alaska’s Arctic Wildlife refuge will not solve our nation’s energy crisis, but it will destroy one of the worlds most unique animal habitats. The Arctic National Wildlife Refuge would satisfy only six months' worth of the nation's oil needs while oil drilling would "destroy" a wilderness that is home to the 150,000 animals of the Porcupine animal group. Our nations natural refuges should not be turned to destruction when a solution to a problem can be found else where. In addition to not being economically productive, drilling for oil will do nothing to help energy shortages experienced throughout the United States, while still destroying one of the only habitats of its kind in the world. Despite common thought, the Alaskan refuge is not a snow covered desert. It is important to what exactly would be destroyed if the United States decides to drill for oil. The Arctic Refuge is among the most complete and undisturbed ecosystems on earth. The Arctic Refuge contains an impressive variety of arctic wildlife. The rich variety of wildlife found within the Refuge includes more than 160 bird species, 36 kinds of land mammals, 9 marine mammal species, and 36 types of fish. The reality is that opening the Arctic refuge to drilling will accomplish little except destroying one of the last pure preserves of its kind in the world. Another reason why it would be unwise to drill is because it is just not cost efficient. For the oil industry to invest, the Refuge must hold a lot of oil, and the oil must sell for a high enough price for long enough to recover costs and earn profits. We need to think of a solution that will affect us today and will alleviate our problems. In exchange for this short-term return, we would have to pay a very high long-term price, threatening one of the planet's most unique animal and plant habitats. Scientific analyses by the US Fish & Wildlife Service have concluded that drilling would severely harm the refuge's abundant populations of caribou, polar bears, musk oxen, and snow geese.

Commanding heights episode Essay

Commanding heights: The New Rules is the third film in the series and is about the 21st century economy. PBS sponsored the film under the direction of Michael Sullivan to inform the public about the economic situation. They speak about how the economy adapted to what is today. How the world nationalized third world countries allowing exchange and investment. Episode 3 addresses the current and future problems of a globalized world. That’s the structure of the film. The film clearly, thoroughly, and excitingly explains this through historic facts and stories told by citizens who lived during the changes. This is not an economics lesson but rather a high dramatic event that impacts peoples lives. Commanding Heights shows that it is people who create the ideas, it is people who accept or reject them, it is people who profit or suffer by them. The series travels to the locations where events happened, and in many cases, interviews the people who made them happen, from Bill Clinton to Milton Friedman to workers in various countries. Episode three encompasses that along with globalization and an open free market and period of peace and advancement of technologies and ideological views will happen. A global economy ill introduce a path to peace and prosperity for rich and poor nation alike. The New Rules of the Gamin 1992, things looked bad for the U. S. economy: Western Europe was assembling into a powerful economic alliance (the European Union) to compete with America, Japan’s economy was unstoppable, and the U. S. was in the worst recession in decades. The North American Free Trade Agreement (NAFTA) was a trade agreement between the U. S. , Canada and Mexico that lowered, but did not eliminate, many trade barriers between the three countries. In large part, Bush wanted to get NAFTA approved to strengthen the U. S. economy against Japan and Europe. The negotiations for NAFTA began under his term. NAFTA became an issue during the 1992 elections. Bush wanted NAFTA 100%, Perot wanted it cancelled, and Clinton wanted NAFTA, but with important amendments added to force Mexico to raise labor and pollution standards so they would have to compete on more even footing with American workers. Clinton won, and his plan was put into action. The labor unions gave Bill Clinton the support he needed to win. NAFTA led to a huge increase in the amount of trade between the three countries. Likewise, each country ad significant GDP growth that was directly attributable to the freer trade. The biggest growth was in Mexico, in wealth and employment. The impact on the U. S. was that 400,000 American Jobs were lost to more competitive workers and factories south of the border, American unions sustained major and lasting damage to their political influence and membership, and the gap between rich and poor Americans grew wider. As in previous cases, deregulation and freer trade benefitted a whole economy in aggregate while severely hurting a small percentage of people and massively benefitting some companies that are able to take advantage of the new rade policies. In the global economy, annual trade in tangible goods and services is worth $8 trillion while trade in currencies is worth $288 trillion. U. S. workers in both public and private sectors have trillions of dollars invested in work-related retirement portion of American workers’ pensions is invested overseas. Thus, most American workers are significantly invested in the global economy. After NAFTA, Clinton pursued other important trade liberalization policies across the world. One of his major accomplishments was strengthening the global free market in the aftermath of Communism’s collapse. In 1994, Mexico faced political and economic crisis, and the country came to the brink of defaulting omits foreign debt. There was real fear that the country, left to its own devices, could fall into chaos, and millions of refugees would head north into the U. S. Clinton had crisis meetings with his advisors over the issue and decided to give Mexico a $50 billion loan. It worked to stabilize the country, Mexico repaid the money ahead of schedule, and the U. S. looked like a benevolent actor to the world. However, many critics considered Clinton’s actions to be a prime example of moral hazard: By bailing out the Mexican government, the U. S. was in essence bailing out thousands of private investors who had put money into the country without properly weighing the risks. The bailout signaled the private sector that it could make similarly bad future investment choices without fear since the U. S. would again rescue them. Critics feared this would make sovereign debt crises more likely. â€Å"Globalization† is defined as the free flow of goods, services, capital, and labor across national borders. China has a number of â€Å"Free Trade Zones,† which are small geographic areas in which companies can build factories to build and export nything with very few restrictions. The Zones are exempt from China’s otherwise strict business and export laws. Seaports and airports are usually located very close tour within Free Trade Zones. At long last, Japan’s economic bubble burst in the 1990’s and the country slid into a major recession that it never really recovered from. American fears of Japan someday â€Å"taking over† the world economically were quickly and permanently dispelled. In the beginning America was behind Japan and Europe in trading and economic growth, thus NAFTA was created to allow trading between North America. The United States were now able to trade freely with Canada and Mexico, providing great economic growth for all three countries in North America. When trading borders opened up Tijuana became a massive manufacturer of televisions for the United States, Northern Mexico was able to open up many Jobs giving opportunities to Southern Mexicans. This created an economic boom in North America leading to a surge that would be able to compete with other Countries, because this would allow us to buy cheaper goods. In the end although it hurt American Jobs because Mexico’s goods were cheaper, Both Bush and Clinton wanted NAFTA to succeed in order to put labor and pollution laws into effect in all the countries involved.

Compare/Contrast of Political Parties Essay

INDEPENDENT PARTY 1) Values and Beliefs -Protect the right to life of the innocent unborn; -Stop the undeclared wars which are daily costing American lives and billions of tax dollars; -Stop reckless spending, including foreign aid, and take care of America’s domestic needs -End debt financing of both Federal and State governments; -End the Federal income tax, and restore a tariff based revenue system; -Immediately terminate international trade agreements such as NAFTA, WTO, and the proposed FTAA, and stop sending high paying American jobs to foreign countries; -Reduce immigration, and stop all government subsidies to illegal aliens; no driver’s licenses for illegals; deport all illegal aliens; -Defend America’s moral values; keep God in the pledge of allegiance; -Support high standards in education, including encouragement of private schools and home schooling; -Stop the pillaging of consumers and taxpayers by the energy/utility monopolies; -Defend Second Amendment rights; -Restore a debt free, interest free money system; -Uphold traditional marriage and family values; 2)History of the Independents -California’s American Independent Party has been a ballot qualified political party since 1968. The American Independent Party, which now has some 300,000 registered members in California, is affiliated at the national level with the Constitution Party. -On July 8, 1967, formal organization of California’s American Independent Party was completed at a convention held in Bakersfield. â€Å"A new party is urgently needed today because the leaders of the two existing parties, Democrat and Republican, have deserted the principles and traditions of our nation’s founding fathers. Control of the government, under the domination of these two existing parties, has left the hands of the people our government was created to serve.† -In 1967, Gov. George C. Wallace of Alabama was on the move to run for President on a new party ticket. Wallace supporters greeted with enthusiasm the formation of the American Independent Party. -On August 3, 1968, the delegates to the state convention of the American Independent Party adopted the party’s first platform. This document held tremendous significance for A I P activists who had joined the new party because they wanted major changes in public policies. 3)Why Independent? -The American Independent Party has kept alive the best of the American principles which have largely been abandon by the Democrat and Republican parties.The American Independent Party has survived for over a quarter of a century because the party has had effective leaders, along with a popular platform, emphasizing respect for life, fiscal responsibility, a reduced role of government in people’s lives, reduction of the tax burden, control of crime, protection of American businesses, workers, and farmers from  unfair foreign competition, and an America first non-interventionist foreign policy. 4)Young Independents Today -Some have suggested that the American Independent Party may be out of step with young Americans whose views are alleged to be radically different from those of middle aged and older Americans. The commitment of Young Americans to the country’s traditional moral, political, and economic values, however, remains comparable to that of other age groups. -The future of the American Independent Party is assured by a market for its views among young Americans who do not have years of commitment to the dominant parties. Today, the political climate in America is changing. The people are looking for new voices, new choices, new vehicles for political expression. The people are looking to the American Independent Party for leadership. POPULIST PARTY 1)History -delegates adopted the platform of the People’s party also called the Populist party -the populists represented a grand coalition of farmers, laborers, and reformers, which aimed to put government back into the hands of the people -populist leaders were diverse and colorful -the populists chose their candidates amid calls for restricted immigration and a shorter workday for industrial laborers. -the party also aimed to convince the government to allow the free coinage of silver, a measure that would make silver, not just gold, legal tender. -despite action by the farmers alliances and the grangers the plight of thousands of farmers worsened. -the platform of the populist party called for extensive reforms -reformers believed that farmers and workers should be freed from the exploitative practices of banks and railroads and merchants -the populists gained 14 seats in congress, won 2 governorships, and received the largest number of popular votes cast for any third party in the 1800s -by the time of the 1896 election the populist party itself had declined but some of its ideas entered the mainstream -the continuing depression forced the democratic party into a more radical position on one key issue-unlimited coinage of silver -this stance led many populists to support the democratic candidate william jennings bryan of nebraska -populism began to decline -one factor limited populism’s strength in the south -peoples party failed to gain wide support in the south -the southern alliance advised its memebers to support major party candidates who favored agricultural interests -the underlying reason for the failure of populism in the south was the issue of white supremacy -the southern alliance feared that populism might lead to gains for african americans

Biography on Dave Mirra essays

Biography on Dave Mirra essays Dave started riding at the age of four with his brother, and was jumping curbs and flying over dirt ramps by the time he turned five. He never thought he was special when he entered his first BMX freestyle contest in Columbus, Ohio at age ten and placed second to last. But he just loved riding a bike and discovered that he was best suited to ramp riding. Soon he mastered the vert slopes and got on sponsored teams, with Haro bikes being the first at age 13. By the time he graduated from high school, he was a professional BMX rider and considered one of the top ramp riders in the world. He has gone on to become known as 'Miracle Boy' for the many incredible moves he added to the sport. It could also be due to the fact that he is the athlete that has won more medals in BMX history, and has a combined total of 12 X Games medals in street and vert (- 9 gold and 3 silver). Dave holds the record for the most gold medals won for and X Games athlete. In the 2000 X-Games he pulled off the first-ever double back flip in a competition. In 2000, Dave was one of two extreme sports athletes to be recognized as a notable sports icon in all sports with his media value alone reaching an approximate $2.5 million. Currently residing in Greenville, North Carolina, Dave is respected among his rider buddies as the leading influencer of BMX. He was voted BMX Rider of the Year at the 2001 ESPN Action Sports Dave has appeared on the cover of Sports Illustrated for Kids, and has been featured in Rolling Stone, ESPN the Magazine, Good Morning America, Disney's The Jersey Show, several celebrity challenges and The Late Show with David Letterman. Dave has also contributed a lot back to th ...

Corporate social responsibility provides greater benefits to the Assignment

Corporate social responsibility provides greater benefits to the organisation than it does to society and other stakeholders - Assignment Example The rationale of CSR has been articulated in numerous ways, which emphasize on building of sustainable businesses, which require stable economies, markets and communities (Roberts and Baker 7). Needless to mention that, most individuals ranging from students, managers or even employees are conversant to Corporate Social Responsibility, in businesses, community, and media. Although, CSR has various definition that are given in accordance to the organizations and or companies that practise it, it is clear that social responsibility is a mandate that decision makers ought to make in protecting and improving the welfare of the society in respect to their own interests (Cosans 396) Constituents of Corporate Social Responsibility: benefits to the organisation Corporate Social Responsibility is made up of constituents, which are necessary in making an impact in both the companies and the society. To begin with, companies have responsibilities other than the usual production of goods and ser vices to make a profit. Basically, the responsibilities entail assisting in solving important social challenges particularly those that they have contributed towards. Moreover, corporations have wider elements as compared to stockholders where the impact goes beyond market transactions to serve a larger population of people in the society (Mulligan 266). Never the less, CSR in companies can be tricky especially when it comes to application of ethical standards. For instance, most of the morals standards present in companies tend to conflict with each other because it is still unclear which standards should take priority. Somewhat, companies have the responsibility of respecting ethical values and principles in relation to pursuing company objectives, which translate to high profit margins. Of importance to note is that, the ethics of business make a company socially responsible. Once a company practise good business ethics, then it becomes easier for companies to participate in soci al responsibility (Roberts and Baker 8). Enhancing Brand and Image Reputation CSR in an organization or a company ensures that its reputation and brand continuously grow in reference to their practise. Hence, CSR programmes are bound to provide numerous chances especially when they want to communicate to the stakeholders by use of messages. In relation to reputation, CSR is involved in ensuring that it management any reputation risk that may tend to harm the image of the company in one way or another (Bejou 3). Additionally, companies involve themselves in projects within the society that enhance awareness from the public, a situation that translates to an improved reputation. Consequently, companies should be conversant with the needs of the customers, partners and suppliers. The action and behavior of the company toward these three stake holders automatically enhances the company’s brand. Once a company has a good perception in terms of image reputation and brand, a culture of understanding is created between the society and the company (Mulligan 268). For instance, it is the business of companies to works in the interest of behaving responsibly especially when some groups of activists are not comfortable with some of the aspects that have been put forward by the company. Thus, CSR plays a crucial role in ensuring that the company benefits through brand and image reputation. Increased Sales and Customer Loyalty It is evident that CSR does not only entail social

Individual Reflection Report Essay Example | Topics and Well Written Essays - 750 words

Individual Reflection Report - Essay Example In addition, I also had difficulty getting through examinations and processing instructions for my various course requirements. As mentioned, I am not a native speaker and I still have a long way to go mastering the English language. It was extremely difficult particularly whenever I am about to take an exam. Reviewing the course and subjects was already difficult to begin with, especially whenever I had to deal with new words and concepts. So whenever there was an exam, my anxiety doubles up. Definitely, the language barrier was the main reason for slow progress in academics. In my classes, I double my effort to follow the instructions and syllabus needed for the course. Aside from taking notes, I also compare with other students so I could monitor my progress. I consult regularly with my professors to be able to ensure that I am catching up on the lessons. I have already missed a lot of things in my first year and I am determined to make it this time around. I feel that I am improv ing, little by little, so that eventually, I could reach my goals. At present, I am still working on making it better by continuously improving on my communication skills. By this, I do not only mean speaking the language, but more importantly, be able to get along well with other people and build relationships. In school, I am trying again to get better by taking the courses I failed last term, and doubling my efforts to successfully pass them this time. I have started building friendship with other foreign students who also share the same sentiments and hurdles with me. This way, we can assist each other in the adjustment processes. I talk to my professors regarding my performance, and seek help whenever I need it. Guidance is important for me at this point, as I need all the assistance I could get so I could truly get synchronized into the system. I engage in group studies, join groups that would help me improve my performance. I am now focusing on simultaneously mastering the la nguage and learning all the concepts being taught. More than memory work, I have to immerse myself into various situations and participate in activities that would allow me to create relationships and form a support group that would help me improve my performance. Eventually, I want to be really familiar with University life, finish my courses with flying course and eventually get a Degree in Business and Management. I want to have the capacity to eventually apply for a job in UK, a job that would not consider my being non-native a disadvantage. Later on, when I would be getting advanced courses, I would be able to really participate in the learning process even more. My perseverance would eventually lead me towards the achievement of my goals. So far, I think I am a work in progress, as I have already basically learned the language, and can now somehow communicate whenever I have to go out, do my errands, shop or simply interact with other people. I am slowly building my confidence to be able to engage in simple conversations even outside the university. Though there are still new challenges and hurdles that come along now that I am in the university, I think that with careful planning and evaluation, I can get my objectives done in time. CAREER As I said, I am taking up Business and Management because of my goal to secure a long tern job from the private sector. I want to given the chance to apply for corporate job in probably a bank, or in

Emerging Markets Essay Example | Topics and Well Written Essays - 2000 words - 1

Emerging Markets - Essay Example While developing economies are usually flooded with emerging markets, the concept is not novel to developed economies. It is these emerging markets, which when successful in the future, become economic giants in the industry (Garten, 1997). The emerging markets need to consider a lot of geographical and economic concerns before setting in a foreign country. They may be small enterprises or large projects. This paper seeks to evaluate the industry of emerging markets in the United States and see how successful it has been over the years. It would also analyze how these emerging markets have affected the economy of US and all related economies. Emerging markets have had positive impacts and some negative setbacks and this paper would state both sides of the picture. The US is the third largest country in the world comprising an area of 3.79 million square miles. It accommodates over 300 million people in fifty states, and being so, it remains the most populated region in the world. The US is the most ethnically diverse nation in the world with people from all over the world staying there for work, study or leisure. It has a GDP of 14.3 trillion US dollars which proves that it is a relatively economically stable country in the world. However, about 11% of the US population lives below the poverty line (Juster, 1997). It has a very high rate of productivity and high rate of scientific developments and innovations. Also, the unemployment level in the US is fairly low and inflation is under control too. The US is bordered by the Pacific and Atlantic Oceans making it a favorable site for water travel. Also, it has sufficient nuclear weaponry and a strong army to ensure its defense against the worldly enemies. The US also enjoys fairly good relations with most economies of the world and it stands as a much unbiased nation with a lot of

Use of cell phones in a workplace Essay Example for Free

Use of cell phones in a workplace Essay The use of mobile phones has become pervasive not only for social interaction but also in the day to day transactions. Tyrone Garage is a business where they are four (4) mechanics that travel around the country to repair customer vehicles 24 hours a day and also travel overseas to buy different car parts. Among the types of repair that Tyrone and his employees perform are tyre change or repair, tyre rotation, brake jobs, oil change , belt change etc . The use of nokia phones allow the mechanics to ommunicate with the garage, so they aware of where they are and can provide them with new customer information. The phones also allow the mechanics to communicate with customers such as getting the customer directions to their location. Although the garage and mechanics will call each other on the same network, the calls to customers will be on different networks. Tyrone Garage has a monthly plan with Digicel which includes 1500 minutes a month to be split between all the mechanics phones and this is used for communication between both the arage and the customers. Tyrone Garage employees use the nokia cell phones to set reminders of appointments that customer would have made. The nokia phones allows you to instantly check appointments you can also install an instant messaging chat whatsapp so you can communicate with an employee, or with the person you intend to meet at any time to confirm, clarify, or alter meeting details (e. g. location, time). This means that if meeting needs to be changed at the last minute, all parties involved can be informed quickly, even if on their way there. Three security features of Nokia phones that are useful to employees of Tyrone Garage are: Remote locking using SMS messages or security code Remote locking allows the device lock to be activated remotely where they will be a timing set on it where it can lock on it own. The end user themselves can do this by sending an sms from another user or sms emulator as long as a remote locking code is predefined in the terminal. Remote locking code can be from 5 to 20 characters or digits. If the device is lost the person who finds the phone still cannot activate any nformation on the phone even if they change the sim card because when they insert the new sim card and turn on the phone that person has to enter a security code before the phone is actually boot up. This feature reduces the risk of the device being stolen and increases the possibility of having the phone returned if misplaced or lost since it has the company label at the back of the phone. Call Barring This feature allows the employer to restrict all international outgoing calls from employees phone

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94